Microbial community dynamics during start-up of acidogenic anaerobic reactors

*Corresponding author.Tel.:+65-8741315;fax:+65-7791635.E-mail address:cveliuwt@.sg (W.-T.Liu).0043-1354/02/$-see front matter r 2002Elsevier Science Ltd.All rights reserved.PII:S 0043-1354(02)00022-2reduces the total reactor volume in comparison with a single anaerobic digester[3].With the proper enrichment of microbial communities,the two-stage anaerobic process has been demonstrated to effectively treat complex pollutants from municipal[4]and industrial wastewaters[5–9].Start-up is an important step in establishing proper community structure in the two-stage anaerobic treatment processes as well as other biological treat-ment processes.It is reported that poor start-up in biological treatment systems can lead to ineffective removal of soluble nutrients[10]and organic matters [11],or a prolonged period of acclimation[12]. To confirm successful start-up,the changes of organic matters or products in the effluent are monitored along with the characterization of commu-nity structure dynamics.Cultivation methods are traditionally used to characterize microbial community structure in wastewater treatment processes,but are time-consuming,labor-intensive,and susceptible to biases(e.g.,medium selection,culturability)toward non-predominant culturable bacteria[13].Recent advanced molecular techniques overcome the biases associated with the conventional cultivation method, and have been applied to the identification of indi-vidual specific microbial groups within a mixed popula-tion at different phylogenetic levels in anaerobic treatment processes[14,15,12].This approach has shown successful monitoring of the start-up of anaerobic digesters[11,16].This study aimed to monitor and evaluate microbial community dynamics(i.e.,populations profiles and distributions)and process performance during start-up of acidogenic reactors under thermophilic and meso-philic conditions.Specifically,denaturing gradient gel electrophoresis(DGGE)of PCR amplified community 16S-rDNA was used to readily compare the community structure of these two acidogenic reactors.Simulta-neously,dot-blot hybridization with group-specific oligonucleotide was used to quantitatively monitor the relative abundance of the domains Bacteria and Archaea,and various methanogens within the domain Archaea.2.Material and methods2.1.Source of sludge samplesTwo 2.8-l acidogenic reactors were operated in parallel to treat a dairy wastewater under mesophilic (371C)and thermophilic(551C)conditions,respectively. Both reactors were seeded with methanogenic granular sludge obtained from an upflow anaerobic sludge bed (UASB)reactor treating the same dairy wastewater as described previously[17].In both acidogenic reactors, the pH was kept at5.5to suppress the methanogenic activities through the regulation of wastewater pH.The hydraulic retention time was kept at24h,and the organic loading rate was4000mg-COD/l d.The con-centration of volatile fatty acid(VFA)comprising mainly C2–C5fatty acids and the methane produced in the effluent were analyzed as described previously[18]. Sludge samples in both reactors were taken on days13, 19,33,40,50and71,and immediately frozen atÀ801C prior to analysis.munityfingerprint as determined by denaturing gradient gel electrophoresisGranular sludge samples were initially washed and homogenized using a tissue grinder.Total community DNA of the sludge samples was extracted as described previously[19],and used as the DNA template in the PCR amplification of DGGE analysis.The primer set used for the amplification of16S-rDNA from members of the domain Bacteria was U968F-gc[20]and U1392R [21].The primer set for the amplification of16S-rDNA from members of the domain Archaea was ARC622f (with a GC-clamp)[22]and ARC934r[23].PCR was conducted using a thermal cycler(Perkin-Elmer 9600)and a thermal program as described previously [22].PCR products were verified by electro-phoresis in a0.8%agrose gel,and then analyzed by DGGE.Denaturing gradient gel electrophoresis of the PCR-amplified16S-rDNA was performed using a D-Code system(BioRad Laboratories).The denaturing gradi-ents used to separate the amplified Bacteria and Archaea rDNA[22]were40–60%and45–65%(a mixture of7M urea and40%of deionized formamide),respectively,in a6%or an8%polyacrylamide gel.The gel was electrophoresed in1X TAE buffer at200V and601C for4h.After electrophoresis,the image of the DGGE pattern was stained with silver stain[24]and captured using a CCD camera(Kodak Digitial Science TM).The intensity of individual bands was analyzed using gel analysis software KDS1D 2.0.Cluster analysis was further performed to statistically discern pattern among DGGEfingerprints throughout the start-up according to a protocol described previously[19].For further identification of predominant DGGE bands in indivi-dual samples,DGGE fragments were cut and eluted in 50m l of TE buffer overnight.Recovered DNA was used as DNA template in a following PCR amplification with the same DGGE primer set as used previously.The PCR products were analyzed in a separate DGGE for purity, and sequenced with a PRISM Dye Terminator Reaction kit(Applied Biosystem)using an autosequencer Model 377(Applied Biosystems).W.-T.Liu et al./Water Research36(2002)3203–3210 32042.3.RNA extraction and membrane hybridizationAfter being gently washed with a buffer solution (7mM K2HPO4,3mM KH2PO4,0.13M NaCl,pH7.2), the sludge samples were suspended in a commercially available nucleic acid isolation kit,Tri-Reagent@ (Molecular Research Center,Inc.).The mixture was homogenized for3min on a Mini-Beadbeater TM(Bios-pec Products)with glass beads(diameter100m m)as described previously[25].The RNA was separated from the homogenate,precipitated,washed and re-suspended according to the manufacturer’s instruction(Molecular Research Center,Inc.).Membrane hybridization was carried out according to the procedure described by Stahl et al.[25]and Raskin et al.[26].In brief,the extracted RNA wasfirst denatured and blotted onto a magna charged nylon membrane(Hybond-N+)by a manifold device(Shlei-cher&Schuell Co.).The membrane was then baked at 801C for30min.,and pre-wetted with a hybridization buffer(0.9M NaCl,50mM sodium phosphate,5mM EDTA,10X Denhardt solution,0.5%sodium dodecyl sulfate[SDS],0.5mg/ml of poly[Adenosine],pH7.0)in screw-cap hybridization tubes(Robbins Scientific,CA, USA)at401C for2h in a rotating hybridization oven (Robbins Scientific).After the pre-hybridization,the buffer was replaced by a hybridization solution contain-ing labeled DNA oligonucleotide probe,and incubated at401C for18h.The probe was labeled with32P using Ready-to-Go TM T4Polynucleotide Kinase(Pharmacia) and purified by MicroSpin TM G-25Columns(Pharma-cia).After the hybridization,the membrane wasfirst washed with a washing solution(1%SDS,0.15M NaCl and0.015M sodium citrate,pH7)at401C for2h,and then at the desired dissociation temperature(T d)for 30min.The sequences and T d0s of those domain-and group-specific oligonucleotide probes used were listed in Table1.After hybridization,the radioactive signal was detected using a Phosphor Image Analyzer(Molecular Dynamics),and analyzed with the quantitation soft-ware,ImageQuant(Molecular Dynamics).The radio-active signal of the sample in individual hybridization was normalized against the reference and expressed as the percentage of that obtained from the universal probe.Reference strains used were Methanobacterium formicicum(ATCC33274),Methanosarcina barkeri (ATCC43241),Methanococcus deltae(ATCC35294), and Methanogenium wolfei(ATCC43114).3.Results3.1.Performance of acidogenic reactorsTwo acidogenic reactors with methanogenic granular sludge as a seed source were acclimatized with dairy wastewater under mesophilic and thermophilic condi-tions for a period of71days.During this start-up period,reactor performance was constantly monitored. Fig.1illustrates the amount of VFA and methane produced daily throughout the start-up period in those two acidogenic reactors.Both two reactors exhibited an increase in daily VFA production from189–245mg-COD/l d at day3to1230–1326mg-COD/l d at day71, and a decrease in daily methane production to less than 400mg-COD/l d at day71.It is apparent that the VFA production is closely related to the decrease in methane production.Soon after the start-up,the granulated structure of the seed sludge disintegrated in both the reactors.The extent of disintegration in the thermophilic reactor was considerably more severe than in the mesophilic reactor,leading to a high washout rate of sludge biomass in the effluent of the thermophilic reactor.Table1Oligonucleotide probesProbe OPD name a Specificity Sequence(50–30)HybridizationconditionsReferencesSlot blot(T d)UNIV1392S-*-Univ-1392-a-A-15Almost all life ACGGGCGGTGTGTAC421C[25]EUB338S-D-Bact-0338-a-A-18Bacteria GCTGCCTCCCGTAGGAGT421C[13]ARC915S-D-Arch-0915-a-A-20Archaea GTGCTCCCCCGCCAATTCCT561C[25]MG1200S-O-Mmic-1200-a-A-21Methanomicrobiales CGGATAATTCGGGGCATGCTG531C[26] MSMX860S-O-Msar-0860-a-A-21Methanosarcinaceae GGCTCGCTTCACGGCTTCCCT601C[26]MX825S-F-Msae-0825-a-A-23Methanosaetaceae TCGCACCGTGGCCGACACCTAGC591C[26]MB1174S-F-Mbac-1174-a-A-22Methanobacteriaceae TACCGTCGTCCACTCCTTCCTC571C[26]MC1109S-F-Mcoc-1109-a-A-20Methanococcales GCAACATAGGGCACGGGTCT551C[26]Y=T/C.a OPD,oligonucleotide probe database[13].W.-T.Liu et al./Water Research36(2002)3203–321032053.2.Microbial community as determined by DGGE Significant shift in microbial community structure during the start-up of these two reactors was observed using DGGE.Fig.2illustrates the shift of microbial community in the domain Bacteria .At least nine detectable DGGE bands were observed in the seed sludge on day 0.After lowering pH in reactors from the initiation of start-up,DGGE community fingerprint (i.e.,band numbers and intensity)observed in the seed sludge differed significantly from that observed in the thermophilic reactor.Five detectable DGGE bands in the seed sludge disappeared in the acidogenic sludgeafter day 13.In contrast,fewer detectable bands in the seed sludge disappeared in the mesophilic reactor during the first 13days after start-up.The rate of the microbial community change in the mesophilic sludge throughout these 71days was also gradual and less significant than that took place in the thermophilic reactor.It was apparent that a more significant change in the microbial community occurred in the thermophilic reactor within the first 13days than after day 13.After day 13,the community structures in both the reactors became relatively stable.These differences in predominant populations and community shifting rate in both the reactors were mainly related to operational temperature.Fig.3illustrates the DGGE profiles of the domain Archaea in these two reactors.At least six detectable DGGE bands were found in the seed sludge,and were found to be common to detectable bands in both the acidogenic sludges throughout the start-up period.Four predominant bands identified in the seed sludge (i.e.,bands 1,3,4and 5)and their corresponding bands in the acidogenic sludge sample at day 71were recovered,purified and sequenced.Results indicated that bands with the same electrophoresis position tended to have nearly identical 16S-rRNA partial sequences.Band 1in the seed sludge and band 6in both the acidogenic sludges were closely related to Methanobacterium formicicum (99%in sequence similarity).Sequences of bands 3–5in the seed sludge differed from bands 8–10in the acidogenic sludges by only one nucleotide,and were closely related to Methanosaeta concillii 16S-rRNA sequence (>99%sequence identity).The high degrees of sequence identity suggested that either these microbial populations were phylogenetically closely related,or slightly different rRNA gene copies were recovered from one microorganism.Furthermore,at least nine addi-tional Archaea DGGE bands were not detected inthe5001000150020002500DayD a i l y a c c u m u l a t i o n o f m e t h a n e a n d V F A s (m g /l /d )Fig.1.Methane production rate and VFAs production rate during the start-up of the mesophilic and thermophilic acidogenic reactors:methane production rate in the mesophilic (B )and thermophilic reactors (’);VFAs production rate in the mesophlic (m )and thermophilic reactors (J).Fig.2.Bacterial community structures in the mesophilic and thermophilic acidogenic reactors as monitored using DGGE.W.-T.Liu et al./Water Research 36(2002)3203–32103206seed sludge.Among them,four bands (i.e.,bands 1,2,13and 14at day 71)were successfully recovered and identified.Bands 1and 2in the acidogenic sludges were affiliated with Methanobacterium sp.VeH52(92–94%in sequence similarity)in the family of Methanobacteria-ceae .Bands 13and 14were closely related to the genus Methanogenium in the family Mathanomicrobiaceae .Possibly due to the low DNA content,bands 1,2,6,7,11,12and 15present in the acidogenic sludges at day 71could not be recovered and sequenced.In general,community structures of the samples at the end of the start-up within each reactor tended to be more closely related to each other than the samples from the beginning of the start-up and the seed sludge.Although DGGE technique was effective in detecting microbial community shift and in identifying the phylogenetic affiliation of predominant methanogenic populations in the acidogenic reactors,it suffered from biases introduced during the DNA extraction and PCR amplification steps [27].To validate DGGE results,dot-blot hybridization with rRNA-targeted oligonucleotide probes was performed to quantitatively monitor the microbial community shift.3.3.Microbial communities as quantified by membrane hybridizationThe dynamics of Archaea and Bacteria populations during the start-up of these two acidogenic reactors was quantitatively monitored using dot-blot hybridization with rRNA-targeted oligonucleotide probes .Dot-blot hybridization with probes ARC915and UNIV1392(Fig.4a)indicated that Archaea and Bacteria population accounted for approximately 34.1%and 63.1%,respec-tively,of the total 16S-rRNA in the seed sludge.Thirteen days after the start-up,the bacterial population in the mesophilic acidogenic reactor increased to 90.3%at day 13and further to 93.8%at day 40.Along withtheFig.3.Archaeal community structures in the mesophilic and thermophilic acidogenic reactors as monitored usingDGGE.Sludge samplesA b u n d a n c e o f A r c h a e a a n dB a c t e r iaSludge samplesA b u n d a n c e o f d i f f e r e n t m e t h a n o g e n i c p o p u l a t i o n s(a)(b)Fig.4.(a)Abundance of Archaea (p )and Bacteria (’)forsludge sample taken from the start-up of the mesophilic and thermophilic acidogenic reactors as determined by membrane hybridization with probes EUB338and ARC915targeting the domains Bacteria and Archaea .(b)Distribution of different phylogenetic methanogens during the start-up of the mesophilic and thermophilic acidogenic reactors as determined by mem-brane hybridization with rRNA-targeted oligonucleotide probes listed in Table 1.The methanogenic populations monitored included Methanomicrobiales (p ),Methanosarcina-ceae (’)and Methanobacteriaceae W.-T.Liu et al./Water Research 36(2002)3203–32103207decrease in methane production rate(Fig.1),Archaea population significantly decreased to4.3%at day40. Similar shifts of Archaea and Bacteria populations were observed in the thermophilic sludge.The dominance of three major methanogens[i.e., Methanobacteriales(probe MB1174),Methanococcales (probe MC1109)and Methanomicrobiales(probes MSMX860and MG1200)]within the domain Archaea was further monitored with rRNA probes specifically targeting these groups.Fig.4b shows that Methanomi-crobiales was the most abundant group(26.7%of the total16S rRNA)among these methanogens monitored in the seed sludge,followed by Methanobacteriales and Methanococcales.Within the order Methanomicrobiales, Methanosarcinaceae represented21.5%of the total16S-rRNA in the seed sludge.These results allied with those observed from DGGE profiles.The dominant methano-gens identified by DGGE profiles were Methanosaeta and Methanobacterium;the former belongs to family Methanosarcinaceae and the latter order Methanobac-teriales.These methanogenic populations significantly decreased during the start-up of these two acidogenic reactors.4.DiscussionStart-up as a critical step of process operation in biological treatment processes was related to a number of factors(e.g.,seed sludge source,initial organic loading rate,wastewater types,HRT/SRT)[36].A number of studies have further provided insights into the start-up of biological treatment systems through the monitoring of microbial community dynamics using molecular-based methods[28,11,16].All these studies suggested that successful start-up is required for the establishment of a proper microbial community con-forming the desired physiological functions.For anae-robic digesters treating municipal solid wastes and simple organic matters,inocula source tended to play a less significant role than operational conditions(e.g., reactor temperature)[11].Furthermore,dynamics of methanogenic composition was related to the type and concentration of VFAs in reactors[11,16].This study revealed significant shifts in the microbial community dynamics during start-up of these two acidogenic anaerobic reactors using the molecular-based approach.Based on community DGGEfingerprint and dot-blot hybridization,less than2weeks were needed to establish a desire microbial community in the acidogenic reactors.However,it took a longer period to obtain a microbial community showing stable metabolic activity. Findings in this study further suggested that reactor types and growth pH were two major determinants to the microbial community shift during start-up of the acidogenic reactors.The seed sludge used was taken from anaerobic granular sludge,in which the microbial community was likely composed of hydrolytic bacteria, and acid-utilizing bacteria forming syntrophic associa-tion with aceticlastic and hydrogenotrophic methano-gens(Figs.2–4).However,operational conditions(e.g., low SRTand HRT,and low pH)for the acidogenic reactors were apparently detrimental to the maintenance of the syntrophic association between acetogens and methanogens.Therefore,a significant decrease in methanogen Archaea from B34%to2–5%of the total 16S-rRNA was observed along with an increase in daily VFA production and a decrease in daily methane production.Observations on thefinal microbial struc-ture established in the acidogenic reactors were similar to the observation based on by MPN enumeration[29] that hydrogenotrophs in the acidogenic sludge were only 1–10%of the total population in the sludge of a single-stage reactor.Similar observations on the distribution of Bacteria and Archaea populations were obtained from a number of full-scale acidogenic reactors[15].The difference in the Bacteria DGGEfingerprint between the seed sludge and the acidogenic sludge at day 71further suggested that predominant bacteria involved in the hydrolysis and acidogenesis of the organic matter were different between the granular seed sludge and the acidogenic sludge.These DGGE bands disappeared from the bacterialfingerprint of the seed sludge were likely those of syntrophic bacteria commonly found in the methanogenic sludge[30,31].Conversely,new DGGE bands found in the acidogenic sludge possibly represent hydrolytic bacteria predominating under low pH anaerobic environment.The decrease in the aceto-genic syntrophic bacteria was highly correlated to the decrease in its syntrophic partner,Archaea populations. Rapid disintegration of the granular sludge was also observed during start-up of the acidogenic reactors. Previous studies using electron microscopies clearly showed that species resembling Methanosaeta were abundant at the interior of the seed sludge and many other biogranules[18,32].Predominance of Methano-saeta in the granular sludge was likely due to its low K s value to acetate[33],and itsfilamentous morphology, which was critical to the granule formation[32,33].As a result of sludge disintegration,Methanosaeta was exposed to a high VFA concentration and a low pH environment,and rapidly decreased in abundance together with its syntrophic counterpart,leading to washout from the reactor.This study suggested that the breakdown of the syntrophic association between methanogens and syntrophic bacteria was more rapid in the thermophilic reactor than in the mesophilic reactor.Temperature was another major determinant affecting the microbial populations established in the acidogenic reactors.DGGEfingerprinting results(Fig.2)indicated that Bacteria community shift in the thermophilic sludgeW.-T.Liu et al./Water Research36(2002)3203–3210 3208was apparently more significant than in the mesophilic sludge within thefirst13days,suggesting a higher growth rate for thermophilic bacteria[34].Thisfinding correlated with the observation of Griffin et al[11]that a thermophilic anaerobic digester is easy to establish than a mesophilic reactor.Furthermore,differences in pre-dominant bacterial populations between the mesophilic and thermophilic reactors were well allied with that reported by Sekiguchi et al.[35].In summary,this study demonstrated the molecular techniques as effective tools in monitoring the dynamics of microbial community in acidogenic bioreactors during reactor start-up.DGGE profiles and dot-blot hybridization results both showed that a considerable shift in microbial community occurred in anaerobic reactors in less than13days after the start-up of the reactor or the decrease in pH to5.5,but a longer period of time was required to establish a stable microbial community structure and metabolic activity. AcknowledgementsThe authors would like to thank the Hong Kong Research Grant Council for the partial support of this study(HKU7004/98E),and to the Institute of Mole-cular Biology of the University of Hong Kong for their technical assistance.HHPF would also like to thank the Croucher Foundation for the Senior Research Fellow-ship.References[1]Fang HHP,Liu Y.Anaerobic wastewater treatment in(sub-)topical regions.In:Proceedings of the Establishment and Evaluation of Advanced Water Treatment Technology Systems using Functions of Complex Microbial Commu-nity,Tokyo,Japan,2000,March6–8.p.109–18.[2]Gujer W,Zehnder AJB.Conversion processes in anaerobicdigestion.Water Sci Tech1983;15(8/9):127–67.[3]Pohland FG,Ghosh S.Developments in anaerobicstabilization of organic wastes F the two-phase concept.Environ Lett1971;1:4.[4]Fongastitkul P,Mavinic DS,Lo KV.A two-phasedanaerobic digestion process:concept,process failure and maximum system loading rate.Water Environ Res 1994;66:243–54.[5]Beccari M,Bonemazzi F,Majone M,Riccardi C.Interaction between acidogenesis and methanogenesis in the anaerobic treatment of olive oil mill effluents.Water Res1996;30:183–9.[6]Ghosh S,Jerger D,Henry MP,Sajjad A.Rapid-ratethermophilic,single-stage and two-phase methane fermen-tation of synfuel-industry wastewaters.Proceedings of the First World Congress International Water Association, vol.4,Paris,France,2000,July3–7.p.141–9.[7]Hanaki K,Matsuo T,Kumazaki K.Treatment of oilycafeteria wastewater by single-phase and two-phase anaerobicfilter.Water Sci Tech1990;22:299–306.[8]McDougall FR,Anderson GK,Evison LM,Kasapgil B,Papagiannopoulos I.The effect of wastewater character-istics on pre-acidification.Proceedings of the IAWQ Conference on Pre-treatment of Industrial Wastewaters, October’93,Athens,Greece,1993.[9]Viturtia AM,Alvarez JM,Cecchi F.Two-phase contin-uous anaerobic digestion of fruit and vegetable wastes.Resources Conserv Recycl1995;13:257–67.[10]Cech JS,Hartman petition between polyphosphateand polysaccharide accumulating bacteria in enhanced biological phosphate removal systems.Water Res 1993;27(7):1219–25.[11]Griffin ME,McMahon KD,Mackie RI,Raskin K.Methanogenic population dynamics during start-up of anaerobic digesters treating municipal solid waste and biosolids.Bioeng Biotech1998;57:342–55.[12]Wu J-H,Liu W-T,Tseng I-C,Cheng S-S.Characterizationof4-methylbenzoate-degrading methanogenic consortium as determined by the small-subunit rDNA sequence analysis.J Biosci Bioeng2001;91(5):449–55.[13]Amann RI,Ludwig W,Schleifer K-H.Phylogeneticidentification and in situ detection of individual microbial cells without cultivation.Microbiol Rev 1995;59:143–69.[14]Harmsen HJM,Kengen HMP,Akkermans ADL,StamsAJM.Phylogenetic analysis of two syntrophic propionate-oxidizing bacteria in enrichments cultures.Syst Appl Microbiol1995;18:67–73.[15]Raskin L,Zheng D,Griffin ME,Stroot PG,Misra P.Characterization of microbial communities in anaerobic bioreactors using molecular probes.Antonie van Leeu-wenhoek.Int J Gen Mol Microbiol1995;68(4):297–308.[16]Leclerc M,Delbes C,Moletta R,Godon J-J.Single strandconformation polymorphism monitoring of16S rDNA Archaea during start-up of an anaerobic digester.FEMS Microbiol Ecol2001;34:213–20.[17]Fang HHP,Chung DWC.Anaerobic treatment ofproteinaceous wastewater under mesophilic and thermo-philic conditions.Water Sci Tech1999;40(1):77–84. [18]Fang HHP,Chui HK,Li YY.Microbial structure andactivity of UASB granules treating different wastewaters.Water Sci Tech1994;30(12):87–96.[19]Liu WT,Marsh TL,Cheng H,Forney LJ.Characteriza-tion of microbial diversity by determining terminal restriction fragment length polymorphisms of genes encoding16S rRNA.Appl Environ Microbiol 1997;63:4516–22.[20]Heuer H,Krsek M,Baker P,Smalla K,Wellington EM.Analysis of actinomycete communities by specific amplifi-cation of genes encoding16S rRNA and gel-electrophore-tic separation in denaturing gradients.Appl Environ Microbiol1997;63:3233–41.[21]Ferris MJ,Muyzer G,Ward DM.Denaturing gradient gelelectrophoresis profiles of16S rRNA-defined populations inhabiting a hot spring microbial mat community.Appl Environ Microbiol1996;62:340–6.[22]Chan OC,Liu W-T,Fang HHP.Study of microbialcommunity of brewery-treating granular sludge byW.-T.Liu et al./Water Research36(2002)3203–32103209denaturing gradient gel electrophoresis of16S rRNA gene.Water Sci Tech2000;43(1):77–82.[23]Giovannoni SJ,DeLong EF,Olsen GJ,Pace NR.Phylogenetic group-specific oligonucleotide probes for identification of single microbial cells.J Bacteriol 1988;170:720–6.[24]Riesner D,Steger G,Zimmat R,Owen RA,WagenhoferM,Hillen W,Vollabach S,Henco K.Temperature-gradient gel electrophoresis of nucleic acids:analysis of conforma-tional transitions,sequence variations,and protein-nucleic acid interaction.Electrophoresis1989;10377–89.[25]Stahl DA,Flesher B,Mansfield HR,Montgomery eof phylogenetically based hybridizarion probes for studies of ruminal microbial ecology.Appl Environ Microbiol 1988;54(5):1079–84.[26]Raskin L,Poulsen LK,Nouera DR,Rittmann BE,StahlDA.Quantification of methanogenic groups in anaerobic biological reactors by oligonucleotide probe hybridization.Appl Environ Microbiol1994;60(4):1241–8.[27]Wilson IG.Inhibition and facilitation of nucleic acidamplification.Appl Environ Microbiol1997;63:3741–51.[28]Forney LJ,Liu W-T,Guckert JG,Kumagai Y,NamkungE,Nasu M,Nishihara T,Yamaguchi H,Larson RJ.Structure of microbial communities in activated sludge: potential implications for assessing the biodegradability of chemicals.Ecotox Environ Safe2001;49(1):40–53. [29]Zhang TC,Noike parison of one-phase and two-phase anaerobic digestion processes in characteristics ofsubstrate degradation and bacterial population levels.Water Sci Tech1991;23:1157–60.[30]Boone DR,Bryant MP.Propionate-degrading bacteriumSyntrophobacter wolinii sp.nov.gen.Nov.,from methano-genic ecosystems.Appl Environ Microbiol1980;40(3): 626–32.[31]McInerney MJ,Bryant MP,Hespell RB,Costerton JW.Syntrophomonas wolfei gen.Nov.sp.nov.,an anaerobic syntrophic fatty acid-oxidizing bacterium.Appl Environ Microbiol1981;41:1029–39.[32]Guiot SR,Pauss A,Costerton JW.A structured model ofthe anaerobic granule consortium.Water Sci Tech 1991;25(1):1–10.[33]Schmidt JE,Ahring BK.Granular sludge formation inupflow anaerobic sludge blanket(UASB)reactors.Biotech Bioengrg1996;49:229–46.[34]Zinder SH,Cardwell SC,Anguish T,Lee M,Koch M.Methanogenesis in a thermophilic(581C)anaerobic digestor:Methanothrix sp.as an important aceto-clastic methanogen.Appl Environ Microbiol1984;47: 796–807.[35]Sekiguchi Y,Kamagata Y,Syutsubo K,Ohashi A,HaradaH,Nakamura K.Phylogenetic diversity of mesophilic and thermophilic granular sludges determined by16S rRNA gene analysis.Microbiology1998;144:2655–65.[36]Fang HHP,Lau IWC.Startup of thermophilic(551C)UASB granules treating brewery wastewater.Water Res 1996;34(5/6):445–52.W.-T.Liu et al./Water Research36(2002)3203–3210 3210。