T790M EGFR
- 格式:pdf
- 大小:287.40 KB
- 文档页数:7
CONCLUSIONS—Combining target molecule isolation via a biotinylated probe with PNA-enriched TaqMan real-time PCR provides a major improvement for detecting the EGFR T790M resistance mutation.Non–small-cell lung cancer (NSCLC)3 patients harboring EGFR 4 (epidermal growth factorreceptor)-activating mutations are initially responsive to small-molecule tyrosine kinaseinhibitors (TKIs) such as gefitinib and erlotinib; however, almost all of these patientsdevelop drug resistance after prolonged treatment (1). For example, T790M, an acquiredmutation that renders NSCLC patients resistant to gefitinib or erlotinib, is found inapproximately 50% of tumors from patients who have acquired resistance to these kinaseinhibitors (1–4). The presence of the T790M mutation in a primary lung tumor is consideredclinically important and is a contraindication to the use of small-molecule TKIs fortreatment (1–4). Similarly, the emergence of the T790M mutation in plasma from patientstreated with TKIs is an indication of developing resistance (5).Methods have been developed to detect the T790M mutation, with detection limits rangingfrom 1 mutant allele in 10 wild-type alleles to 1 in 2000 (6–9). These methods include apeptide nucleic acid (PNA)-clamping method (10, 11). PNAs have been widely used in PCRreactions as a “clamp” to inhibit the amplification of wild-type DNA and thereby enrich formutant alleles (12). Detection limits for this method currently range from 1 mutant allele in100 wild-type alleles to 1 in 1000 (10, 11). There is an increasing need, however, to furtherimprove the detection of EGFR T790M because DNA with the T790M mutation can beinitially present as a minor clone in a cancer that subsequently becomes drug resistant (13).It would be important to be able to screen tumors from NSCLC patients for the existence ofthe T790M mutation before they undergo TKI treatment, because patients with evidence ofT790M may derive an even briefer benefit from EGFR TKI therapy (14). Furthermore, thedetection of EGFR T790M in a lung cancer before any therapy could change the treatmentfrom gefitinib to an irreversible EGFR inhibitor that is effective against the T790M mutation(15).We demonstrate that biotinylated probe–based purification of a target from genomic DNAproduces a major improvement in PNA-PCR–based mutation detection by increasing thesensitivity for detecting the mutation to at least 1 mutant allele in 40 000 wild-type alleles.Reference human male genomic DNA was purchased from Promega and used as the wild-type DNA in dilution experiments with DNA containing the T790M mutation (H1975 cellline). DNA was extracted from cell lines with the QIAamp DNA Blood Maxi Kit (Qiagen).Primers and probes were synthesized by Integrated DNA Technologies. DNA wasquantified with a NanoDrop spectrophotometer (Thermo Scientific).Real-time PCR reactions were performed in a 25-μL volume in the presence of a dye thatbinds to the DNA minor grove (LCGreen Plus +; Idaho Technology) and with 20 ng genomicDNA prepared directly from cell lines. To quantify copies of EGFR exon 20, we seriallydiluted genomic DNA with human male genomic DNA calibrator. The final concentrationsof the other PCR reagents were as follows: 1× GoTaq Flexi Buffer (Promega), 0.63 U ofGoTaq Flexi DNA polymerase (Promega), 0.2 mmol/L of each de-oxynucleosidetriphosphate, 0.2 μmol/L forward primer (5′-GCTGGGCATCTGCCTCA-3′), 0.2 μmol/Lreverse primer (5′-CAGGAGGCAGCCGAAGG-3′), 2.5 mmol/L MgCl 2, and 0.1× LC-Green Plus +. The size of the PCR amplicon is 67 bp. The PCR cycling was performed on aCepheid SmartCycler ™ machine as follows: 95 °C for 120 s and 50 cycles of 95 °C for 15 s3Nonstandard abbreviations: NSCLC, non–small-cell lung cancer; TKI, tyrosine kinase inhibitor; PNA, peptide nucleic acid.4Human genes: EGFR , epidermal growth factor receptor; GAPDH , glyceraldehyde-3-phosphate dehydrogenase.NIH-PA Author Manuscript NIH-PA Author ManuscriptNIH-PA Author Manuscriptand 60 °C for 30 s (fluorescence reading on), followed by DNA melting from 60 °C to 95 °C at a temperature-ramping rate of 0.2 °C/s. Genomic DNA containing at least 106 copies of EGFR exon 20 molecules were digested in a 480-μL reaction volume containing 1×NEBuffer 2 (New England Biolabs), 1× BSA, 100 U each of Rsa I, Eco RI, Bam HI, and Eco RV. The reaction was incubated at 37 °C for 3 h and then purified in an Ultracel YM-30Microcon column (Millipore). DNA was eluted in 30 μL water. To enrich for EGFR exon 20, we added a 5′-biotinylated probe (biotin–Spacer 18–GCCTGCTGGGCATCTGCCTCACCTCCACCG; synthesized by Integrated DNA Technologies) to the purified digested genomic DNA and diluted the probe to a final concentration of 33 nmol/L with 6× SSPE Buffer (American Bioanalytical) in a 45-μL volume. The mixture was denatured at 100 °C for 2 min in a PCR thermocycler and then quickly cooled on ice for 5 min. The hybridization was then performed in a thermocycler for 16 h at 58 °C. The hybridization mixture was then purified with an Ultracel YM-30Microcon column and eluted in 40 μL water. We washed 10 μL Dynabeads M-270Streptavidin (Invitrogen) 3 times with 1× binding and washing buffer (5 mmol/L Tris-HCL,pH 7.5, 0.5 mmol/L EDTA, and 1 mol/L NaCl) and resuspended the beads in 40 μL of 2×binding and washing buffer. The 40-μL hybridization mixture of purified probe and target was captured by mixing it with the 40 μL of processed Dynabeads and incubating the mixture on a shaker for 1 h at room temperature. The beads were washed 3 times with 1×binding and washing buffer supplemented with 1 mL/L Tween 20, twice with 1× binding and washing buffer, and once with water. Finally, the beads were resuspended in 15 μL water, denatured at 95 °C for 2 min, and placed immediately on DynaMag magnets (Invitrogen). The suspension was recovered for further analysis.The PNA-clamp reaction components were similar to those for the LCGreen dye quantification of EGFR exon 20 described above, except for the use of a locked nucleic acid–modified TaqMan probe and PNA clamp, as previously reported (11), instead of the LCGreen dye. The final concentrations of the TaqMan probe and PNA were both 0.2 μmol/L. Approximately 100 ng of genomic DNA or, alternatively, 2 μL purified target were usedfor T790M detection. The PCR cycling conditions were 95 °C for 120 s and 70 cycles of 95°C for 15 s and 60 °C for 30 s (fluorescence reading on). PCR products were purified withexonuclease I (New England Biolabs) and shrimp alkaline phosphatase (USB/Affymetrix).We then used primer 5′-40T-GCTGGGCATCTGCCTCA-3′ (Integrated DNA technologies)to sequence the purified product by the Sanger method. Precautions were taken to minimizecarryover contamination, and PCR tubes were prepared and uncapped in a negative-flowhood. All experiments were repeated from starting material at least 4 independent times.As shown in Fig. 1A in the Data Supplement that accompanies the online version of thisBrief Communication at /content/vol57/issue5, genomic DNA isfirst digested by a restriction endonuclease (Rsa I in this case) into fragments, one of whichcontains the entire target region between 2 closely spaced restriction sites. The duplexescontaining the hybridized probe and EGFR exon 20 are bound to the streptavidin-coatedmagnetic beads and washed. EGFR exon 20 single-stranded DNA is released from the beadsby brief heat denaturation. A PNA clamp–based real-time PCR with a TaqMan probecontaining a locked nucleic acid matching the T790M mutation [as described by Miyazawaet al. (11)] is then used to quantify the T790M mutation (see Fig. 1B in the online DataSupplement). With the biotinylated probe, we achieved an enrichment in EGFR exon 20 ofat least 1000-fold relative to other genomic DNA fragments. This enrichment estimate isbased on the amount of isolated product and results obtained with input genomic DNA in aTaqMan-based real-time PCR targeting the GAPDH (glyceraldehyde-3-phosphatedehydrogenase) gene (data not shown). This result translates into a recovery efficiency forEGFR exon 20 of approximately 20%–30% relative to the input genomic DNA.NIH-PA Author ManuscriptNIH-PA Author ManuscriptNIH-PA Author ManuscriptWe diluted genomic DNA from the H1975 cell line with the T790M mutation by 1000- to40 000-fold with wild-type DNA. To enable the detection of low-level mutations, we usedgenomic DNA containing approximately 106 copies of EGFR exon 20 for isolation via thebiotin probe. To evaluate the reproducibility of the biotin-isolation process and to enable afair comparison of the mutation-detection limit of PNA clamp–based PCR, we measured thecopy number of EGFR exon 20 several times in independent experiments before performingthe PNA-PCR amplification. LCGreen-based real-time PCR analyses of EGFR exon 20fragments containing the T790M mutation isolated from dilutions into wild-type DNA(1000- to 40 000-fold dilution) demonstrated equal numbers of copies of EGFR exon 20 (seeFig. 2 in the online Data Supplement). The LCGreen dye does not discriminate betweenwild-type and mutant sequences and therefore can be used to quantify EGFR exon 20 copynumber for all samples. The real-time PCR calibration curve was established with a seriallydiluted human control genomic DNA of known concentration, as we have previouslydescribed (9).We used equal numbers of EGFR exon 20 copies isolated from wild-type DNA to testserially diluted T790M mutations via PNA probe–enriched real-time PCR. When genomicDNA is used as the starting material (Fig. 1A), the detection limit is 1 T790M allele in 1000wild-type alleles, a result in agreement with Miyazawa et al. (11). The inability todistinguish lower concentrations of the mutation is due to increased background signals(false positives) generated by the wild-type DNA (Fig. 1A). In contrast, the approachinvolving isolating the biotin target can clearly detect T790M mutations at concentrations aslow as 1 mutant allele in 40 000 wild-type alleles (Fig. 1B), because the wild-type samplesare reproducibly not generating false-positive signals.To better understand the origin of the background signals from wild-type samples whenstarting from genomic DNA, we used genomic DNA and biotin-isolated starting DNA andsequenced the PNA-PCR product from the 1:1000 (i.e., 1 mutant allele among 1000 wild-type alleles) dilution and wild-type samples. Wild-type DNA from genomic DNA producesfalse-positive T790M signals (see Fig. 3 in the online Data Supplement), possibly because ofpolymerase misincorporations in early PCR cycles; however, wild-type DNA from biotin-isolated DNA does not show the T790M C>T mutation at this position. Using PNA-PCRmay require several PCR cycles to accumulate enough copies of the target molecules forefficient binding by the PNA probe, which may allow polymerase misincorporations tooccur in wild-type DNA samples when starting from genomic DNA, but not when biotinprobes are used.Target purification via biotinylated probes has previously been used to increase the numberof starting target copies before constant denaturant capillary electrophoresis or restrictionfragment length polymorphism analysis (16, 17). The present work demonstrates that formethods such as PNA-PCR that operate by enriching the mutation during PCRamplification, biotin probe isolation of the target further improves PCR-based mutationdetection by avoiding PCR errors at early PCR cycles. Because of the relatively largeamount of starting genomic DNA required for the present procedure (approximately 5 μg),this approach is intended primarily for screening tumor tissue or cell lines for rare mutations.The present improvement should also be applicable for detecting other PNA clamp–enrichedmutations or to alternative methods that enrich mutations during the PCR, such as restrictionendonuclease–mediated selective PCR (18, 19) or coamplification at lower denaturationtemperature–PCR (20, 21).AcknowledgmentsResearch Funding: G.M. Makrigiorgos, NIH (grants CA-138280, CA-135257, and CA-090578).NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author ManuscriptRole of Sponsor: The funding organizations played no role in the design of study, choice of enrolled patients,review and interpretation of data, or preparation or approval of manuscript.References 1. Jänne PA. Challenges of detecting EGFR T790M in gefitinib/erlotinib-resistant tumours. Lung Cancer. 2008; 60(Suppl 2):S3–9. [PubMed: 18513582]2. Pao W, Miller VA, Politi KA, Riely GJ, Somwar R, Zakowski MF, et al. Acquired resistance of lung adenocarcinomas to gefitinib or erlotinib is associated with a second mutation in the EGFR kinase domain. PLoS Med. 2005; 2:e73. [PubMed: 15737014]3. Kobayashi S, Boggon TJ, Dayaram T, Jänne PA, Kocher O, Meyerson M, et al. EGFR mutation and resistance of non-small-cell lung cancer to gefitinib. N Engl J Med. 2005; 352:786–92. [PubMed:15728811]4. Engelman JA, Jänne PA. Mechanisms of acquired resistance to epidermal growth factor receptor tyrosine kinase inhibitors in non-small cell lung cancer. Clin Cancer Res. 2008; 14:2895–9.[PubMed: 18483355]5. Kuang Y, Rogers A, Yeap BY, Wang L, Makrigiorgos M, Vetrand K, et al. Noninvasive detection of EGFR T790M in gefitinib or erlotinib resistant non-small cell lung cancer. Clin Cancer Res.2009; 15:2630–6. [PubMed: 19351754]6. Thomas RK, Nickerson E, Simons JF, Jänne PA, Tengs T, Yuza Y, et al. Sensitive mutation detection in heterogeneous cancer specimens by massively parallel picoliter reactor sequencing. Nat Med. 2006; 12:852–5. [PubMed: 16799556]7. Inukai M, Toyooka S, Ito S, Asano H, Ichihara S, Soh J, et al. Presence of epidermal growth factor receptor gene T790M mutation as a minor clone in non-small cell lung cancer. Cancer Res. 2006;66:7854–8. [PubMed: 16912157]8. Vikis H, Sato M, James M, Wang D, Wang Y, Wang M, et al. EGFR-T790M is a rare lung cancer susceptibility allele with enhanced kinase activity. Cancer Res. 2007; 67:4665–70. [PubMed:17510392]9. Li J, Wang L, Jänne PA, Makrigiorgos GM. Coamplification at lower denaturation temperature-PCR increases mutation-detection selectivity of TaqMan-based real-time PCR. Clin Chem. 2009;55:748–56. [PubMed: 19233916]10. Beau-Faller M, Legrain M, Voegeli AC, Guérin E, Lavaux T, Ruppert AM, et al. Detection of K-Ras mutations in tumour samples of patients with non-small cell lung cancer using PNA-mediatedPCR clamping. Br J Cancer. 2009; 100:985–92. [PubMed: 19293811]11. Miyazawa H, Tanaka T, Nagai Y, Matsuoka M, Sutani A, Udagawa K, et al. Peptide nucleic acid-locked nucleic acid polymerase chain reaction clamp-based detection test for gefitinib-refractoryT790M epidermal growth factor receptor mutation. Cancer Sci. 2008; 99:595–600. [PubMed:18271876]12. Pellestor F, Paulasova P, Hamamah S. Peptide nucleic acids (PNAs) as diagnostic devices forgenetic and cytogenetic analysis. Curr Pharm Des. 2008; 14:2439–44. [PubMed: 18781993]13. Engelman JA, Mukohara T, Zejnullahu K, Lifshits E, Borras AM, Gale CM, et al. Allelic dilutionobscures detection of a biologically significant resistance mutation in EGFR-amplified lungcancer. J Clin Invest. 2006; 116:2695–706. [PubMed: 16906227]14. Maheswaran S, Sequist LV, Nagrath S, Ulkus L, Brannigan B, Collura CV, et al. Detection ofmutations in EGFR in circulating lung-cancer cells. N Engl J Med. 2008; 359:366–77. [PubMed:18596266]15. Li D, Shimamura T, Ji H, Chen L, Haringsma HJ, McNamara K, et al. Bronchial and peripheralmurine lung carcinomas induced by T790M-L858R mutant EGFR respond to HKI-272 andrapamycin combination therapy. Cancer Cell. 2007; 12:81–93. [PubMed: 17613438]16. Bielas JH, Loeb KR, Rubin BP, True LD, Loeb LA. Human cancers express a mutator phenotype.Proc Natl Acad Sci U S A. 2006; 103:18238–42. [PubMed: 17108085]17. Li-Sucholeiki XC, Thilly WG. A sensitive scanning technology for low frequency nuclear pointmutations in human genomic DNA. Nucleic Acids Res. 2000; 28:E44. [PubMed: 10756211]NIH-PA Author ManuscriptNIH-PA Author ManuscriptNIH-PA Author Manuscript18. Fuery CJ, Impey HL, Roberts NJ, Applegate TL, Ward RL, Hawkins NJ, et al. Detection of raremutant alleles by restriction endonuclease-mediated selective-PCR: assay design and optimization.Clin Chem. 2000; 46:620–4. [PubMed: 10794742] NIH-PA Author Manuscript19. Amicarelli G, Shehi E, Makrigiorgos GM, Adlerstein D. FLAG assay as a novel method for real-time signal generation during PCR: application to detection and genotyping of KRAS codon 12mutations. Nucleic Acids Res. 2007; 35:e131. [PubMed: 17932053]20. Li J, Wang L, Mamon H, Kulke MH, Berbeco R, Makrigiorgos GM. Replacing PCR with COLD-PCR enriches variant DNA sequences and redefines the sensitivity of genetic testing. Nat Med.2008; 14:579–84. [PubMed: 18408729]21. Milbury CA, Li J, Makrigiorgos GM. Ice-COLD-PCR enables rapid amplification and robustenrichment for low-abundance unknown DNA mutations. Nucleic Acids Res. 2011; 39:e2.[PubMed: 20937629] NIH-PA Author ManuscriptNIH-PA Author ManuscriptFig. 1. Comparison of PNA-enriched TaqMan real-time PCR with biotin-isolated EGFR exon 20molecules and the same technique with whole genomic DNA as starting material (A), Quantification of the EGFR exon 20 T790M mutation by PNA-enriched TaqMan real-time PCR directly from genomic DNA. (B), Quantification of the EGFR exon 20 T790M mutation by PNA-enriched TaqMan real-time PCR from a biotin-purified target. 1:1000indicates 1 T790M allele in 1000 wild-type alleles. NTC, no-template control.NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript。