Molecular basis of Cyperus difformis cross-resistance to ALS-inhibiting herbicides

Molecular basis of Cyperus difformis cross-resistance to ALS-inhibiting herbicides S.Ntoanidou a,N.Kaloumenos b,G.Diamantidis a,P.Madesis c,I.Eleftherohorinos a,⁎a Aristotle University of Thessaloniki,School of Agriculture,Thessaloniki,Greeceb Syngenta Crop Protection UK Ltd.,Jealott's Hill International Research Centre,Bracknell,Berks,UKc Institute of Applied Biosciences-CERTH,6th Km.Charilaou-Thermi Road,Thessalonikia b s t r a c ta r t i c l e i n f oArticle history:Received20July2015Received in revised form7September2015 Accepted8September2015Available online xxxxKeywords:Cyperus difformi sals gene mutationHerbicide cross-resistanceIn vitro ALS activity,intron Applications of64times higher rates of azimsulfuron and halosulfuron-methyl failed to reduce by50%growth of 10putative resistant(R)Cyperus difformis(smallflower umbrella-sedge)populations collected from ricefields located in Northern Greece.However,the growth rate of the susceptible(S)population was reduced by50% by1/4of the recommended rate of both herbicides.The als gene sequencing identified point mutations at Pro-197position,leading to amino acid substitution by Ala or Ser of the ALS enzyme.The in vitro activity of the ALS enzyme indicated that the I50values(herbicide concentration required for50%reduction of the ALS activity) ranged from10.7to55.5μM azimsulfuron and from6.7to50.6μM halosulfuron-methyl,whereas the respective values for the S population were0.09and0.11μM.These results strongly support that cross-resistance of10 C.difformis populations was due to point mutations of the als gene,which resulted in a less-sensitive ALS enzyme. This study reports the presence of a1240bp intron in the C.difformis als gene with the Pro-197point mutations near the splice junction.©2015Elsevier Inc.All rights reserved.1.IntroductionAcetolactate synthase(ALS,EC2.2.1.6),also known as acetohy-droxy acid synthase(AHAS),is the target enzyme for sulfonylurea, imidazolinone,triazolopyrimidine,sulfonylamino-carbonyl-triazolinone, and pyrimidinylthiobenzoate herbicides[1].This enzyme catalyzes two parallel reactions in the biosynthetic pathway of the branched-chain amino acids valine,leucine,and isoleucine,which are considered essential for plant growth and their inhibited biosynthesis is lethal for most plant species.The ALS binding sites of the abovementionedfive herbicide clas-ses are near to ALS active site and partially overlapping[2,3].However, the sulfonylurea herbicides bind closer to ALS active site than imida-zolinone herbicides,and this explains their higher activity(more potent ALS inhibitors than imidazolinones)and why a point mutation at binding sites can cause resistance in one or more herbicide classes and different cross-resistance patterns[1].The ALS-inhibiting herbicides comprise the largest site-of-action group(with54active ingredients across the abovefive chemical clas-ses)and have been widely used in world agriculture since they were first introduced in1982[1].Their importance in all crop systems is due to their efficiency at low rates,flexibility of use,favorable environ-mental profile and low mammalian toxicity in comparison with other herbicide alternatives[4].Although resistance to ALS-inhibiting herbicides can be endowed by either alteration of the ALS enzyme or by enhanced rates of herbicide metabolism[5,6,7],most of the recorded cases of the ALS herbicide re-sistance are due to alteration of the ALS enzyme which results from a point mutation in the als gene.In particular,this mutation leads to amino acid substitution,which alters the structure of the ALS enzyme and consequently its binding site to herbicides.According to ALS muta-tion database,the amino acid substitutions that confer herbicide resis-tance to ALS-inhibitors are at the positions of Ala-122,Pro-197,Ala-205,Asp-376,Arg-377,Trp-574,Ser-653,and Gly-654[5].Among these amino acid substitutions,the most commonly identified are at Pro-197and Trp-574-Leu,and this may reflect herbicide use patterns (sulfonylurea herbicides mostly select for Pro-197mutation,while sul-fonylurea and imidazolinone herbicides mostly select for Trp-574-Leu), selection pressure andfitness cost associated with ALS mutations[1,6].Introns may affect gene expression at many different levels,includ-ing transcription,polyadenylation,mRNA export,translational efficien-cy,and the rate of mRNA decay[8].However,the magnitude of intron-dependent effects can vary tremendously,from almost none to more than a400-fold increase in mRNA levels[9].This is because the intron effect on gene expression is affected by the intron identity,exon se-quence context and intron position within the gene.To our knowledge, Uchino and Watanabe[10]were thefirst to demonstrate the existence of an intron in the als gene of higher plants such as Lindernia species.Evolution of weed resistance to ALS-inhibiting herbicides is a very rapid process and this is confirmed by the fact that153out of the245 weed resistant species worldwide relate with this group of herbicides [11].The rapid appearance of ALS-resistant cases in thefield resultsPesticide Biochemistry and Physiology xxx(2015)xxx–xxx⁎Corresponding author at:Laboratory of Agronomy,School of Agriculture,Aristotle University of Thessaloniki,54124Thessaloniki,Greece.E-mail address:eleftero@agro.auth.gr(I.Eleftherohorinos).YPEST-03860;No of Pages8/10.1016/j.pestbp.2015.09.004 0048-3575/©2015Elsevier Inc.All rights reserved.Contents lists available at ScienceDirectPesticide Biochemistry and Physiology j o u r n a l h o me p a g e:w w w.e l s e v i e r.c o m/l o c a t e/y p e s tfrom the extensive use of ALS herbicides and suggests that many als gene resistance mutations can occur due to a high initial resistance gene frequency,simple and dominant genetic inheritance and lack of majorfitness cost of the resistance mutations[12,13].Cyperus difformis is a highly self-pollinating C3-type annual emer-gent aquatic species[14].It is considered one of the most important weeds in rice as is present in high densities and can reduce rice yield by22–43%[15,16].The most commonly used herbicides for the control of C.difformis in rice are the ALS-inhibiting herbicides azimsulfuron, bensulfuron-methyl,bispyribac-sodium,cyclosulfamuron,ethoxysul-furon,halosulfuron-methyl,imazamox,imazethapyr,imazosulfuron, orthosulfamuron,penoxsulam,and pyrazosulfuron-ethyl[16,17]. Propanil,a photosystem II(PSII)inhibitor,was also used selectively in rice to control both dicotyledonous and monocotyledonous weeds [18].In addition,bentazone,a photosystem II(PSII)inhibitor,is used se-lectively in rice to control both broadleaf weeds and sedges.Taking into considerations that resistance in C.difformis is a classical example of rapid adaptive evolution to ALS-inhibiting herbicides,populations of this weed with cross-resistance to these herbicides have already evolved in rice grown in Korea,Brazil,Spain,Italy,and California[16, 19,20,21,22,23,24].Rice is one of the major crops in northern Greece(county of Thessaloniki and Serres)as it covers24,000ha.In the70%of this area, rice is grown without rotation as a water-seeded monoculture and weed control is mainly based on the use of the ALS-inhibiting herbicides azimsulfuron,bispyribac-sodium,halosuluron-methyl,imazamox, penoxsulam,and on use of the ACCase-inhibiting herbicides cyhalofop-butyl and profoxydim.During the2009growing season,rice growers from the county of Thessaloniki area complained about unsatisfactory control of C.difformis in ricefields after the application of azimsulfuron, which has been used in the area for more than15years.Therefore, whole-plant response studies were conducted1)to determine whether the reduced control of10C.difformis populations collected from the water-seeded ricefields of northern Greece(Thessaloniki)was due to evolution of resistance to azimsulfuron and cross-resistance to halosulfuron-methyl,2)to elucidate the molecular mechanism of resis-tance to ALS-inhibiting herbicides,and3)to measure the in vitro ALS-enzyme activity in the presence of azimsulfuron and halosulfuron-methyl.2.Materials and methods2.1.Seed sourceA roadside survey was conducted during the spring of2009in rice fields located in northern Greece(county of Thessaloniki),where rice is one of the main crops,and failures of C.difformis control with azimsulfuron has been reported during the2007,2008and2009grow-ing seasons.The purpose of this survey was to geolocalizefields with unsatisfactory control of C.difformis.Therefore,ten ricefields were marked during this survey and seeds were collected before rice harvest from the survived weed plants after the azimsulfuron application.Seeds from eachfield were considered as putative resistant(R)population, whereas a susceptible(S)population of C.difformis was provided by the company Herbiseed,UK.During seed collection care was taken to obtain a representative sample from eachfield.Initially,the collected seeds were placed in plastic bags and then were transferred to laborato-ry,air-dried,threshed,placed in paper bags and stored in3–5°C for fur-ther use in the following experiments.2.2.Whole-plant cross-resistance experimentsThe experiments were conducted during2010–2011using 10×10×9cm(0.9L)plastic potsfilled with peat:sand mixture(3:1 by volume).In each pot100–200seeds were placed in depth of 0.5cm.All pots were randomly placed outdoors in a net protected area of the Aristotle University Farm of Thessaloniki,where they were fertilised and watered as needed.When the seedlings reached the two-leaf stage,they were thinned carefully to8per pot.Herbicide ap-plications in all experiments were performed when C.difformis plants had3–4leaves.The herbicide treatments were applied with a portable field plot sprayer(Azo-Sprayers,P.O.Box350–6710BJ EDE,The Netherlands)using a2.4m wide boomfitted with six8002flat-fan noz-zles(Teejet Spray System Co.,P.O.Box7900,Wheaton,IL60188)and calibrated to deliver300L ha−1of water at280kPa pressure.The10C.difformis putative R populations along with the S popula-tion were initially tested for cross-resistance to azimsulfuron(Gulliver 50WG,DuPont Hellas)and halosulfuron-methyl(Permit75WG,ALFA Supplies)applied at20(recommended rate)and160g ai ha−1(higher rate).The recommended rate of bentazone(1.44kg ai ha−1)was also included as chemical control in these trials.All azimsulfuron and halosulfuron-methyl treatments were applied in mixture with0.33% v/v of the adjuvant Dash HC(crop oil,37%w/w methyl oleate palmitate +5%w/w oleic acid+22%w/w fat alcohol polyalkoxylate phosphate). Control of C.difformis populations was assessed by determining the sur-vival rate and the aboveground fresh weight of all survived plants in each pot4weeks after treatment(WAT).Data were expressed as per-centage of the untreated control for each C.difformis population.The ex-periment was conducted twice(two independent experiments replicated in time)using a completely randomized design with four replications.The11C.difformis populations were also used in rate-response ex-periments.In particular,azimsulfuron and halosulfuron-methyl were applied at20,80,160,320,640and1280g ai ha−1to10R populations, whereas the respective herbicide rates used for the S population were 0.312,0.625,1.25,2.5,5,20g ai ha−1.The experiment was conducted twice(two independent experiments replicated in time)using a completely randomized design with four replications.2.3.Amplification and sequencing of the als gene fragmentThe plant material used for the amplification of the als gene was taken from eight plants/pot grown in four pots/population as described above.All R plants and four pots with eight S plants/pot,at three-to four-leaf stage,were treated with the recommendedfield rate of azimsulfuron(20g ai ha−1),whereas four pots with eight S plants/pot were kept untreated.Leaf samples of individual plants survived the azimsulfuron application without the appearance of injury symptoms from the10R populations were harvested,stored at−28°C and subse-quently used for DNA extraction.Also,leaf samples of individual plants from the S population not exposed to herbicide treatment were harvest-ed.At least two leaf samples from two individual plants from each R and S C.difformis population were sequenced.In particular,genomic DNA was extracted from100mg leaf tissue(two individual plants for each population)using the NucleoSpin®Plant II kit(Macherey Nagel GmbH&Co.KG.Postfach101352.D-52,313Düren,Germany)accord-ing to the manufacturers protocol.The amplification of the als gene frag-ment(352bp)from genomic DNA of the R and S populations,which includes the Pro-197codon was performed using the forward5′-ATTC ACCAAGCCCTTACGAG-3′and the reverse5′-GAAGTGGCCAAGAAAAAT GC-3′primers.These primers were designed on the basis of the nucleo-tide and amino acid sequence of the als gene reported by Merrotto et al.(13)for C.difformis.The polymerase chain reaction(PCR)consisted of 0.2mM deoxyribonucleotide triphosphate(dNTPs),1.5mM MgCl2, 10μΜof each forward and reverse primer,2μL of the supplied10×thermophilic buffer,1μL of genomic DNA diluted at20ng/μL and1en-zyme unit(U)of standard Thermus aquaticus(Taq)polymerase in20μL mixture.Amplification was conducted in an MJ Research model PTC-200thermocycler using the following cycles:DNA denaturation for 5min at95°C,and40cycles of30s denaturation at95°C,30s annealing at50°C and1min elongation at72°C.The samples were submitted in a final step of elongation at72°C for5min and the PCR products were2S.Ntoanidou et al./Pesticide Biochemistry and Physiology xxx(2015)xxx–xxxseparated in1%agarose gel.However,as intron was suspected to be present in the als gene fragment comprising Pro-197,the program of the thermocycler was readjusted in order to separate the product of the interested region.So,for the same concentrations of the chemical reagents and for100μLfinal volume,the following cycles were per-formed:DNA denaturation for15min at95°C,and40cycles of30s denaturation at95°C,30s annealing at50°C and1min and20s elon-gation at72°C.The samples were submitted in afinal step of elongation at72°C for5min,whereas the PCR products were analyzed in1%aga-rose gel,separated and purified according to the protocol outlined in the the NucleoSpin®Extract II kit(Macherey Nagel GmbH&Co.KG. Postfach101352.D-52,313Düren,Germany).The purified product was sent immediately for sequencing to the University of Thessaly, School of Medicine,Department of Immunology and Histocompability (Medical school campus,P.C.41110Greece).Each PCR product was se-quenced once,with the reverse primer.The sequencing chromatograms were edited with the ChromasPro software,nucleotide sequences were aligned using Blast(http://www.ncbi.nucleotide)and EMBOSS(http:// www.embil-transeq)was used to translate the nucleotide to peptide sequence.2.4.Intron sequencing of the als gene fragmentLeaf samples were used from the S and two R populations to inves-tigate the intron suspected to be present in the als gene.Total genomic DNA was isolated from leaves with the NucleoSpin®Plant kit (Macherey-Nagel,Germany),according to the manufacturer's protocol. The DNA concentration was estimated by standard spectrophotometric methods at260nm and280nm UV lengths by an Eppendorf BioPho-tometer and the integrity by gel electrophoresis in a0.8%agarose gel. Then,samples were diluted to20ng/μL work concentration.Polymerase chain reactions(PCR)for the isolation of the intron was performed in samples from the three populations mentioned above,in a total volume of50μL,containing20ng total cellular DNA,200mM of each dNTP, 2mM MgCl2,40pmol of primers,5μL10×Taq DNA polymerase buffer, and1U Phusion Taq DNA polymerase.The primer pair used to isolate the intron was the F-GCAAGGCTGGGGTTTGTGTG and R-CGTCGAGTAC AAGATAGTTGTGC,whereas the thermocycler conditions were98°C for3min,98°C for30s,T m annealing20s and72°C for2min.The pro-gram was repeated for40cycles followed by a step of72°C for5min, while the PCR products were analysed on1%agarose gel and the corre-sponding band was cut out and cleaned using the NucleoSpin®Extract II,according to the manufactures protocol.Then,the clean PCR products were A-tailed using1U Kapa Taq DNA polymerase cleaned form the dNTPs and ligated to TOPO TA Cloning®Kit(with pCR®2.1-TOPO®vector)using the MACH I competent cells and sequenced.Total RNA from leaves was isolated using the RNeasy Plant Mini Kit (QIAGEN,UK)and checked through electrophoresis for its integrity. First strand cDNA was synthesized in total volume of20μL by using 1–2μg of total RNA,Superscript II was the reverse transcriptase (Invitrogen)and500μg RACE-RT primer5-GGGCAACTTCTCACTCGG GTTTTTTTTTTTTTTTT-3,2mM dNTPs,1×superscript buffer,100μΜDTT,1unit RNAseOUT™and1unit Superscript II enzyme(added on ice after thefirst step at65°C)in a thermocycler using the following conditions65°C for5min42°C for1h and then70°C for15min.Am-plification of the als gene by PCR was performed with1U with Phusion Taq DNA polymerase1μL cDNA,1×buffer,5mM dNTPs2μM forward ALSTGTTCTCGTTGAGGTTCTCG and reverse RACE-AMP5-GGGCAACTTC TCACTCGGG at the3prime ends.The program used in the thermocycler was98°C for3min,98°C for30s,T m annealing20s and72°C for2min. The program was repeated for35cycles followed by a step of72°C for 5min.The PCR products were analysed on1%agarose gel and the corre-sponding band was cut out and cleaned using the NucleoSpin®Extract II according to the manufactures protocol.A second PCR was performed using as template the clean PCR products.Polymerase chain reactions (PCR)was performed in a total volume of50μL,containing200mM of each dNTP,2mM MgCl2,40pmol of primers,5μL10×Taq DNA po-lymerase buffer,and1U Phusion Taq DNA polymerase and the forward ALSTGTTCTCGTTGAGGTTCTCG and reverse als TATAGGGTCCGGCCAT CTC primers.The program used in the thermocycler was98°C for 3min,98°C for30s,T m annealing10s and72°C for2min the program was repeated for45cycles followed by a step of72°C for5min.The PCR products were analysed on1%agarose gel and the corresponding band was cut out and cleaned using the NucleoSpin®Extract II according to the manufactures protocol.The clean PCR products produced from the genomic DNA and the cDNA were A-tailed using Kapa Taq polymerase and then ligated to TOPO TA Cloning®Kit(with pCR®2.1-TOPO®vec-tor)using the MACH I competent cells and sequenced.The PCR products were directly sequenced in two directions of each fragment with Big Dye terminator v3.1Cycle sequencing kit(PE Applied Biosystems,Fos-ter City,CA,USA)in an automated ABI3730sequencer(PE Applied Biosystems).The primers used to generate the PCR products are M13 F-GTAAAACGACGGCCAG and M13R-CAGGAAACAGCTATGAC,whereas the primers used to sequence the PCR product are F-intron GCAAGGCT GGGGTTTGTGTGR-intron(primer1)CGTCGAGTACAAGATAGTTGTGC (primer2),F-inside intron CTTGGTATTAAGAATCCTTCACAAAG(primer 3),R-inside intron GTAATATTTGGGCCTTGAGTAATCC(primer4).The sequences were aligned with the CLUSTAL W software using the MEGA5and/or Bioedit programmes.Spidey software at NCBI was used in order to identify the intron-exon junction.2.5.ALS extraction and in vitro activity assayThe material used for the ALS activity assay was taken from plants grown in pots as described above.At3-to4-leaf stage,shoot tissue samples from individual R plants survived the application of the azimsulfuron recommended rate without the appearance of injury symptoms and untreated with herbicide S plants were harvested,stored at−80°C and subsequently used for ALS extraction.At least shoot tis-sue samples from three individual plants per sample of each R and S C.difformis population were collected.The procedure outlined by Osuna et al.[24]was used for the enzyme extraction and the subsequent ALS activity assay.More specifically,2g of shoot tissue was harvested and used for extraction procedure.The ex-traction procedure was contacted at4°C.The tissue was ground using extraction buffer(3mL g−1tissue)with0.5g polyvinylpyrrolidone (PVPP).The extraction buffer contained0.1M potassium phosphate pH7.5(KH2PO4/K2HPO4),1mM sodium pyruvate(C3H3NaO3), 0.5mM(MgCl2,),0.5mM thiamine pyrophosphate(C12H19N4O7P2S), 10μΜflavin adenine dinucleotide(FAD),12mM dithiothreitol(DTT), 1mM phenylmethylsulfonylfluoride(PMSF)and glycerol100mL L−1. The homogenized mixturefiltered through one layer of cheesecloth and centrifuged at27.000g for15min.The proteins including the ALS enzyme were precipitated from the crude extract at50%saturation of (NH4)2SO4.Then the mixture was stirred for20min and then centri-fuged at27.000g for15min.The pellet was resuspended in500μL ex-traction buffer and the re-suspension was applied to a Sephadex G-25 PD-10column previously equilibrated with elution buffer[0.1M (KH2PO4/K2HPO4)pH7.5,20mM sodium pyruvate and0.5mM MgCl2.The third and fourth mL collected from the elution of the column were used immediately at the ALS activity assay.The ALS activity was measured by estimation of the acetolactate after conversion to acetoin by decarboxylation in the presence of acid. The reaction started by adding100μL protein extract for the putative re-sistant populations and50μL for the susceptible population to100μL freshly prepared assay buffer[0.08M(KH2PO4/K2HPO4)pH7.5, 0.15M sodium pyruvate,0.15M(MgCl2,),1.5mM ThDP,160μM FAD] containing3,10,25,50,100μΜazimsulfuron or halosulfuron-methyl for the R populations,while for the S population the respective herbi-cide concentrations were0.005,0.01,0.05,0.1,0.2,0.5,1.0μΜ.Potassi-um phosphate0.04M pH7was added to reach afinal volume of 0.25mL.The mixture was vortexed and incubated at37°C for1h.The3S.Ntoanidou et al./Pesticide Biochemistry and Physiology xxx(2015)xxx–xxxreaction was stopped by addition 50μL H 2SO 4(6N)and the reaction tubes were vortexed and heated at 60°C for 15min to facilitate decar-boxylation of acetolactate to acetoin.Acetoin was detected as colored complex (A 520nm )formed after addition 250μL creatine (5g L −1freshly prepared in water)and 250μL α-naphtol (50g L −1freshly prepared in 2.5N NaOH)and incubating at 60°C for 15min.Background was deter-mined using control tubes were the reaction was stopped before the incubation and subtracted.The absorbance values were expressed as percentage of control tubes in which the reaction took place in the ab-sence of azimsulfuron and halosulfuron-methyl.Two experiments,each with a separate shoot tissue extract from dif-ferent plant materials,were conducted per population and each sample at each herbicide concentration was assayed in triplicate.Data obtained from the two experiments were pooled and subjected to nonlinear re-gression analysis using the log-logistic equation [25].2.6.Statistical analysesA combined over time (two experiments)analysis of variance (ANOVA)was performed for the data obtained from the initial screen-ing experiment (fresh weight %of untreated control)using an 11×2×2[11populations by 2herbicides by herbicide treatments]factorial approach.The bentazone data were not included in the ANOVA because this treatment caused 98–100%fresh weight reduction of all popula-tions tested.Differences among treatment means were compared at the 5%level of signi ficance using the LSD test.A combined over time (two experiments)ANOVA was performed for the data obtained from the rate-response experiments conducted for the R populations by using a 2×6×10[2herbicides ×6herbicide treatments ×10populations]factorial approach.Also,a combined over time (two experiments)ANOVA was performed for the data ob-tained from the S population using a 2×6[2herbicides ×6herbicide treatments]factorial approach.Because the ANOVAs indicated no sig-ni ficant treatment by repeated experiment interaction,treatment means were averaged over two experiments and compared at the 5%level of signi ficance using the LSD test.In addition,the untransformed pooled fresh weight data (%of untreated control)were subjected to nonlinear regression analysis using the Seefeldt's log-logistic Eq.(1)[25].y ¼C þD −C50ðÞ½ f gð1Þwhere C =the lower limit,D =the upper limit,b =the slope at the GR 50,and GR 50=the herbicide rate (g ai ha −1)required for 50%reduc-tion of fresh weight.The independent variable (x)was the herbicide rate and the dependent variable (y)was the fresh weight.The GR 50values obtained from these equations were used to calculate the resis-tance ratio (R/S)values by dividing the GR 50of each R population with the GR 50of the S population.A combined over time (two experiments)ANOVA was also per-formed for the data (absorbance measurements)obtained from the ALS activity assays using a 6by 10(6herbicide concentrations by 10C.difformis populations)factorial approach for the R populations,while the combined over time (two experiments)ANOVA performed for the data obtained from the S population was a 2×8[2herbicides ×88herbicide treatments]factorial approach.As the combined ANOVA re-vealed no differences between the experiments,the data (ALS response to herbicide concentration expressed as percentage of the untreated control)from the two ALS activity assays were pooled and subjected to nonlinear regression analysis using the Seefeldt's log-logistic Eq.(2)[25].y ¼C þD −C50ðÞ½ f gð2Þwhere C =the lower limit,D =the upper limit,b =the slope at the I 50,and I 50=the herbicide concentration (μΜ)required for 50%reduction of the ALS catalytic activity.The independent variable (x)was the herbi-cide concentration and the dependent variable (y)was the ALS activity (ALS response to herbicide concentration expressed as percentage of the untreated control).The fitted equations were used to estimate the amount of herbicide required for 50%reduction of the ALS activity (I 50value).Then,the obtained I 50values were used to calculate the resis-tance ratio (R/S)values by dividing the I 50of each R population with the I 50of the S population.3.Results3.1.Whole-plant cross-resistance experimentsIn the initial screening experiments,applications of eight times higher rates of azimsulfuron and halosulfuron-methyl reduced fresh weight of the 10Greek C.difformis populations by 1–40%,whereas the recommended rate of both herbicides reduced fresh weight of the imported population from UK by 96–100%(data not shown).According to these findings,the 10C.difformis populations originating from the rice area of Greece were characterized as resistant (R),while the imported population from UK as susceptible (S).The rate-response experiments indicated that fresh weight of all R populations was reduced 16–35%and 2–22%due to higher rate (1280g ai ha −1=64times higher than the recommended rate)of ei-ther azimsulfuron or halosulfuron-methyl,respectively (Fig.1).TheTable 1Nucleotide and deduced amino acid sequence alignment of als gene fragments,originating from one S and 10R populations showing different point mutations at the codon Pro-197.Populations Susceptibility Pro-197codon c Genotype Number of plants with a speci fic genotype P1d R a TCT b Ser-197/Ser-1971R GCT Ala-197/Ala-1971P2R GCT Ala-197/Ala-1972P3R GCT Ala-197/Ala-1972P4R GCT Ala-197/Ala-1972P5R GCT Ala-197/Ala-1972P6R GCT Ala-197/Ala-1972P7R GCT Ala-197/Ala-1972P8R GCT Ala-197/Ala-1972P9R GCT Ala-197/Ala-1972P10R GCT Ala-197/Ala-1971R TCT Ser-197/Ser-1971P11SCCTPro-197/Pro-1972a R,resistant,S,susceptible.bIUPAC –IUB nucleotide codes.cThe codon positions refer to the standard Arabidopsis thaliana als gene (GenBank:X 51514)and Cyperus difformis als gene (GenBank:EF 061294).dSusceptible population inbold.Fig.1.Fresh weight reduction (%of untreated)of 10R C.difformis populations after the ap-plication of azimsulfuron and halosulfuron-methyl at 1280g ai ha −1(64times than their recommended rate).Mean values are averaged over the two experiments.4S.Ntoanidou et al./Pesticide Biochemistry and Physiology xxx (2015)xxx –xxx。