Cap 1153 s 2 Interpretation一

CAP 137 ANTIBIOTICS ORDINANCE一摘要：To control the sale and supply of certain antibiotic substances.(Amended 40 of 1969 s. 2)[4 June 1948](Originally 21 of 1948 (Cap 137 1950))Cap 137 s 1 Short titleThis Ordinance may be cited as the Antibiotics Ordinance.(Amended 40 of 1969 s. 3)Cap 137 s 2 InterpretationIn this Ordinance, unless the context otherwise requires-"authorized seller of poisons" (获授权毒药销售商) has the meaning assigned to it by the Pharmacy and Poisons Ordinance (Cap 138);"Director of Agriculture, Fisheries and Conservation" (渔农自然护理署署长) includes the senior veterinary officer and any veterinary officer; (Added 23 of 1962 s. 3. Amended L.N. 331 of 1999)"penicillin" (青霉素) has the meaning assigned to it by the regulations made under this Ordinance;"registered dentist" (注册牙医) means a person registered in the dentists register and a person deemed to be a registered dentist under the Dentists Registration Ordinance (Cap 156); (Amended 62 of 1987 s. 10) "registered medical practitioner" (注册医生) means a person registered or deemed to be registered under the Medical Registration Ordinance (Cap 161);"registered pharmacist" (注册药剂师) means a person registered in the register of pharmaceutical chemists or the register of chemists and druggists under the Pharmacy and Poisons Ordinance (Cap 138);"registered veterinary surgeon" (注册兽医) means a veterinary surgeon registered under the Veterinary Surgeons Registration Ordinance (Cap 529). (Replaced 96 of 1997 s. 36)Cap 137 s 3 Substances to which this Ordinance appliesThe substances to which this Ordinance applies are penicillin and such other anti-microbial organic substances produced by living organisms as may be prescribed by regulations made by the Director of Health under section 12 and, where such regulations prescribe a substance produced byliving organisms, the regulations may include any substance the chemical properties of which are identical with or similar to those of the substances so prescribed but which is not produced by living organisms: (Amended 50 of 1955 s. 2; 84 of 1992 s. 12)Provided that this Ordinance shall not apply to antibiotic substances contained in foods for livestock or to such substances which have been specially manufactured for the purpose of supplementing foods for livestock. (Added 50 of 1955 s. 2)Cap 137 s 4 Control of sale and supply of substances to which this Ordinance applies(1) Subject to the provisions of this section, no person shall sell or otherwise supply any substance to which this Ordinance applies or any preparation of which any such substance is an ingredient or part unless he is-(a) a registered medical practitioner, a registered dentist or a registered veterinary surgeon or a person acting in accordance with the directions of any such medical practitioner, dentist or veterinary surgeon, and the substance or preparation is sold or supplied for the purpose of treatment by or in accordance with the directions of thatmedical practitioner, dentist or veterinary surgeon; or (Amended 96 of 1997 s. 37)(b) a person who, although not a registered medical practitioner, practises medicine in a clinic in such circumstances that, by virtue of section 8(8) of the Medical Clinics Ordinance (Cap 343), he is not by reason solely of such practice guilty of an offence under section 28 of the Medical Registration Ordinance (Cap 161) and the substance or preparation is sold or supplied by him solely in the course of his practice in that clinic for the purpose of treatment by him or treatment in accordance with his directions; or (Added 14 of 1964 s. 2)(c) a registered pharmacist or an authorized seller of poisons, and the substance or preparation is sold or supplied under the authority of a prescription signed and dated by such medical practitioner, dentist or veterinary surgeon as aforesaid.(2) No person shall administer by way of treatment any such substance or preparation unless he is such a medical practitioner, dentist or veterinary surgeon or a person acting in accordance with the written directions of any such medical practitioner, dentist or veterinary surgeon, or a holder of a valid permit issued by the Director of Agriculture, Fisheries and Conservation under section 6(2), or a person acting under the direction of a holder of such permit, or a person referred to subsection (1)(b) and such substance orpreparation is administered in the course of his practice in the clinic concerned. (Amended 50 of 1955 s. 3; 23 of 1962 s. 3; 14 of 1964 s. 2; L.N. 331 of 1999)(3) Subsection (1) shall not apply to the sale or supply of any such substance or preparation-(a) to any person who is a holder of a valid permit issued under this Ordinance to deal in such substance or preparation; (Replaced 50 of 1955 s. 3)(b) to any person who is a holder of a valid permit issued by the Director of Agriculture, Fisheries and Conservation under section 6(2), if any substance or preparation so sold or supplied is clearly labelled "for veterinary purposes only" and "只限医治禽畜用"; (Added 23 of 1962 s. 3. Amended 80 of 1997 s. 115; L.N. 331 of 1999)(c) to any such medical practitioner, dentist or veterinary surgeon as aforesaid;(d) to any authority or person carrying on a hospital, clinic, nursing home or other institution providing medical, surgical or veterinary treatment:Provided that this paragraph shall not apply to any hospital, clinic, nursing home or other institution which is required to be registered under the Medical Clinics Ordinance (Cap 343) unless it is so registered; (Replaced 14 of 1964 s. 2)(e) to any person carrying on an institution or business which has among its recognized activities the conduct of scientific education or research, for use by persons engaged in that education or research; or(f) to any public department.(4) The person dispensing a prescription shall comply with the following requirements-(a) if the prescription contains a direction that it may be dispensed a stated number of times or, at stated intervals, it must not be dispensed otherwise than in accordance with the direction;(b) at the time of dispensing there must be noted on the prescription the signature of the prescriber, the name and address of the seller and the date on which the prescription was dispensed;(c) except in the case of a prescription which may be dispensed on more than one occasion, the prescription must for a period of 2 years be retained and kept on the premises on which it was dispensed, in such manner as to be readily available for reference.Cap 137 s 5 Prohibition of possession of substances to which this Ordinance applies(1) Subject to the provisions of subsection (2), no person shall have in his possession or under his control any substance to which this Ordinance applies or any preparation of which any such substance is an ingredient or part.(2) Subsection (1) of this section shall not apply to the following-(a) a registered medical practitioner;(b) a person referred to in section 4(1)(b); (Added 14 of 1964 s. 3)(c) a registered dentist;(d) a registered veterinary surgeon; (Amended 96 of 1997 s. 38)(e) a registered pharmacist;(f) an authorized seller of poisons;(g) a department of Government;(h) any person acting under the direction of a registered medical practitioner, registered dentist or registered veterinary surgeon; (Amended 45 of 1984 s. 2; 96 of 1997 s. 38)(i) a person who is the holder of a valid permit issued under this Ordinance to deal in such substance or preparation; (Amended 23 of 1962 s. 4; 45 of 1984 s. 2)(j) a person who is the holder of a valid permit issued by the Director of Agriculture, Fisheries and Conservation under subsection (2) of section 6; or (Added 23 of 1962 s. 4; 45 of 1984 s. 2. Amended L.N. 331 of 1999)(k) a person in bona fide possession of a substance supplied to him in conformity with section 4. (Added 45 of 1984 s. 2)(Added 50 of 1955 s. 4)。

Si1153 Data ShortProximity/Ambient Light Sensor IC with I 2C InterfaceThe Si1153-AA00/AA09/AA9x is an ambient light sensor, proximity, and gesture detec-tor with I 2C digital interface and programmable-event interrupt output.This touchless sensor IC includes dual 23-bit analog-to-digital converters, an integrated high-sensitivity array of visible and infrared photodiodes, a digital signal processor, and three integrated LED drivers with programmable drive levels. The Si1153 offers excel-lent performance under a wide dynamic range and a variety of light sources, including direct sunlight. The Si1153 can also work under dark glass covers. The photodiode re-sponse and associated digital conversion circuitry provide excellent immunity to artificial light flicker noise and natural light flutter noise. With two or more LEDs, the Si1153 is capable of supporting multiple-axis proximity motion detection. The Si1153 is provided in a 10-lead 2x2 mm DFN package or in a 10-lead 2.9x4.9 mm LGA module with integra-ted LED, and is capable of operation from 1.62 to 3.6 V over the –40 to +85 °C tempera-ture range.Applications:•Wearables •Handsets•Display backlighting control •Consumer electronicsLED1LED2 *LED3 **LIGHT** Pull up to VDD with 47 kOhm resistor* Pull up to VDD with 47 kOhm resistor to select primary I2C address (0x53), or down to GND for alt I2C address 0x52. Rev. 0.9Si1153 LGA Module Basic ApplicationPin Description 2.85x4.9 mm LGA ModuleSi1153 DFN Basic Application Pin Description 2x2 mm DFNTable 1.1. Recommended Operating ConditionsTable 1.2. Ordering GuideSi1153 Data Short | Smart. Connected. Energy-friendly.Rev. 0.9 | 1DisclaimerSilicon Laboratories intends to provide customers with the latest, accurate, and in-depth documentation of all peripherals and modules available for system and software implementers using or intending to use the Silicon Laboratories products. Characterization data, available modules and peripherals, memory sizes and memory addresses refer to each specific device, and "Typical" parameters provided can and do vary in different applications. Application examples described herein are for illustrative purposes only. Silicon Laboratories reserves the right to make changes without further notice and limitation to product information, specifications, and descriptions herein, and does not give warranties as to the accuracy or completeness of the included information. Silicon Laboratories shall have no liability for the consequences of use of the information supplied herein. This document does not imply or express copyright licenses granted hereunder to design or fabricate any integrated circuits. The products must not be used within any Life Support System without the specific written consent of Silicon Laboratories. A "Life Support System" is any product or system intended to support or sustain life and/or health, which, if it fails, can be reasonably expected to result in significant personal injury or death. Silicon Laboratories products are generally not intended for military applications. Silicon Laboratories products shall under no circumstances be used in weapons of mass destruction including (but not limited to) nuclear, biological or chemical weapons, or missiles capable of delivering such weapons.Trademark InformationSilicon Laboratories Inc., Silicon Laboratories, Silicon Labs, SiLabs and the Silicon Labs logo, CMEMS®, EFM, EFM32, EFR, Energy Micro, Energy Micro logo and combinations thereof, "the world’s most energy friendly microcontrollers", Ember®, EZLink®, EZMac®, EZRadio®, EZRadioPRO®, DSPLL®, ISOmodem ®, Precision32®, ProSLIC®, SiPHY®, USBXpress® and others are trademarks or registered trademarks of Silicon Laboratories Inc. ARM, CORTEX, Cortex-M3 and THUMB are trademarks or registered trademarks of ARM Holdings. Keil is a registered trademark of ARM Limited. All other products or brand names mentioned herein are trademarks of their respective holders.Silicon Laboratories Inc.400 West Cesar Chavez Austin, TX 78701USASmart.Connected.Energy-FriendlyProducts/productsQuality/qualitySupport and Community。

12 encoders on each channel strip for optimum instant access • Simple intuitive operation • 96-KHz enabled • Superior signal processing with 40-bit fl oating-point arithmetic • Fully integrated into the NEXUS audio networkAURATUSThe basic idea behind the AURATUS was to develop a compact digital con-sole suitable for predefi ned workfl ows in radio and TV production. Therefore AURATUS features not only a hardwired bus structure but also a user inter-face optimised for quick and simple operation. This ensures that new users will experience a shallow learning curve and secure operation. All relevant channel parameters are adjusted easily using the dual encoders in the chan-nel strip, or alternatively in the master section.The console dimensions are designed for optimal access to all controls and easy viewing of displays and indicators. AURATUS offers a very comfort a ble and convenient working depth. Furthermore, the meter bridge is ex t reme l y low due to the 16:10 screens employed. This provides excellent visual con-tact with the recording studio, video screens / or the stage.AURATUS has several features designed specifi cally for the broadcaster such as audio-follows-video features, remote-controlled fader (On/Off) function, two freely assignable function keys per channel, extensive cue-light signalling, customizable N-1 buses, and timers capable of counting down as well as up.The NEXUS XCMC plug-in card, which is just 3 U × 4 HP in size, handles all the AURATUS audio processing and control data. The card has full access to all audio resources on the NEXUS network and offers the full number of channels and buses even at a sampling rate of 96 KHz.AURATUS supports stereo and multichannel confi gurations. Depending on the actual confi guration, the following resources are available: 46 or 54 input channels, 4 stereo groups, 4 stereo sums, 2 stereo aux buses, 4 mono aux buses, 8 mono mix-minus (N–1) buses, stereo or 5.1 monitoring buses for monitoring the live mix- or playback.The AURATUS offl ine editor offers time and cost benefi ts on tight production schedules. The offl ine editor makes it possible to confi gure an AURATUS while it is still in use on another production. All preparatory work including channel assignments, channel confi gurations etc. are made in a stand-alone editor application running on a Windows PC. Projects are then loaded into the console from SD cards. It also works the other way round. Projects are imported from the console for further processing in the offl ine editor. Console•Modular, custom confi guration, up to 24 faders•Free assignment of audio channels to channel strips•8 operating layers, freely assignable•Instant access to 2 pre-selected layers per channel strip•Master section for monitoring, automation, Logic Control, and commu-nications•Ultra-low power consumption — 16 channel strips consume just86 watts•Console does not require a fan•Talkback-microphone port•Script rest (optional)•Gooseneck / console lamps (optional)User Interface•12 encoders with LED arcs and 14 illuminated keys per channel strip •OLED displays for channel name and layer assignment indication•Hi-res TFT modules for viewing meters and other parameters •Optional integrated NEXUS control PC with built in keyboard•Master section with dual concentric rotary encoders and graphical TFT displays for direct access to console functions such as:• Signal-processing modules• Monitoring path• Bus routing• Automation menu (snapshots)• Timer• TFT displayDisplays and Indicators•Hi-resolution level and dynamics meters on each channel strip:• G raphic EQ curve and panner position display• D ynamics module curve view• B us routing (including pre/post, mute and control groups)• T ouch-controlled information pop-up window for displaying numeric values of recently adjusted mixing parameters•Hi-resolution level and dynamics meters on the master TFT screen:• P ermanent level metering of all bus channels• F urther graphical display areas with characteristics curves• T imer view: 2 independent timers that can be controlled by internal or external eventsAdditional Functions•Stereo link: Input-channel stereo linking (including dynamics side-chain key signals)•Link groups: Audio parameters of multiple channels can be grouped for simultaneous control and adjustment•Master-slave groups: Link selected channels to any master channel •Spill: Instant access to audio parameters which are not available on the console surfaceInputs and outputs•Custom confi gurable I/O interfaces provided by the NEXUS audio network•Microphone inputs: 32-bit TrueMatch A/D converter, > 158 dB (A) dyna-mic range @ 24 dBu•Line inputs: 24-bit TrueMatch A/D converter, > 133 dB (A) dynamic range @ 24 dBu•Line outputs: 24-bit D/A converter, 131 dB (A) dynamic range (typical) @ 24 dBu•Digital audio formats: AES/EBU, AES 42 and S/PDIF, MADI, ADAT, TDIF, SD-SDI and HD-SDI, Dolby E®, Dante•Sample rates 44.1/48 kHz, 88.2/96 kHz•Sample-rate converters (either standard or optional depending on the card type)•XLR, BNC, RJ45, fi bre-optic, or D-Sub ports Console Ports•2x Headphones outputs (6.3 mm jack sockets)•Meter/Goniometer (8 channels): D-sub (15-pin)•1x Talkback microphone: XLR-3, female•Nearfi eld speakers: XLR-3, maleMonitoring Paths• 5.1 monitoring channel (2.0 monitoring channel in stereo mode)•Stereo channel (“Play Back Channel”)• 5.1 solo bus (stereo bus in stereo mode)•Stereo PFL busStatic Automation• A snapshot stores the audio parameters of all processing channels for later recall. Each project holds up to 99 snapshots.•Partial snapshots are also possible, storing only selected settings. Logic Control•Many AURATUS parameters are integrated into the fl exible and comprehensive NEXUS Logic Control system•Audio-follows-video function includes remote-controlled dynamics •Fader-On-backstop function can be queried•40 freely confi gurable user keys in the central master section •Freely confi gurable display areas on the central TFT screen SynchronisationThe NEXUS / AURATUS system synchronises to the following sources:•NEXUS XCPU controller cards with high-precision word clock generators as studio master clock•External word clock or video (requires NEXUS XSYNC card)•Digital audio inputs•Word-clock-failure auto detection and click-free switchover to different source in order of priorityAURUS, AURATUS, CRESCENDO, ON AIR fl ex, CANTUS, CINETRA, NEXUS, and TrueMatch RMC Series are developed and produced by Stage Tec Entwicklungsgesells-chaft in Germany.AURUS , AURATUS , CANTUS , NEXUS , and TrueMatch are national and international registered trademarks of Stage Tec Entwicklungsgesellschaft für professionelleAudiotechnik mbH, Berlin (Germany). Neither presence nor absence of trademark or brand designations or trade descriptions in this manual should be regarded as affecting the legal status of any trademark.The information given in this manual is subject to change without notice. Errors excepted.Stage TecEntwicklungsgesellschaft für professionelle Audiotechnik mbH Tabbertstraße 10-11D-12459 Berlin /G ermany Phone: +49 30 639902-0Telefax: +49 30 639902-32E-Mail: offi***************Signal Processing•40-bit fl oating-point format•Processor-card connection through a single RJ45 link carrying both control messages and the digital audio needed for talkback and moni-toringSignal-Processing Modules (per Channel)•Input Gain•Expander / Noise Gate•EQ & Filter (Multiband, High-Pass & Low-Pass Filter, High & Low Shelving)•Delay •Insert•Direct-Out (Pre/Post Fader)•Compressor / Limiter •Mute•Pre/post-fader bus routing (Aux, N–1)•Pre/post fader listening & metering •Pan (multichannel capable)Reliability•Redundant power supplies (AURATUS and NEXUS), fi bre-optic cables and cards•Automatic self-test and error-message routing via NEXUS •Hot-swap enabledVersions•Consoles available with 8, 16, or 24 channel strips •Custom master-section positioning •Variants: desktop, fi tted, or with console stand •Also available with narrow side panelsPhysical Dimensions•Control surface operating depth: 625 mm •Channel spacing: 38 mm •Console depth: 777 mm•Width (with standard side panels): 814 mm (8 faders), 1146 mm (16 faders), 1479 mm (24 faders)•Height: 313 mm (desktop variant), 1033 mm (with stand)。

5.75.09Section:Prescription DrugsEffective Date: April 1, 2020 Subsection: Neuromuscular Drugs Original Policy Date: June 9, 2011 Subject:Hyaluronic Acid DerivativesPage:1 of 7Last Review Date:March 13, 2020Hyaluronic Acid DerivativesDescriptionDurolane, Euflexxa, GelSyn-3, GenVisc 850, Hyalgan , SodiumHyaluronate, Supartz , Synojoynt*, Triluron, TriVisc, Visco-3 (sodium hyaluronate)Gel-ONE , Hymovis, Monovisc, Orthovisc (hyaluronan)Synvisc, Synvisc-One (hylan G-F 20)Bolded medications are the preferred products*These medications are included in this policy but are not available in the market as of yetBackgroundOsteoarthritis of the knee is a disease in which the elastoviscous property of the synovial fluid in the knee joint becomes diminished, resulting in less protection and shock absorption. Durolane, Euflexxa, Gel-One, GelSyn-3, GenVisc 850, Hyalgan, Hymovis, Monovisc, Orthovisc, Sodium Hyaluronate, Synvisc, Synvisc-One, Supartz, Synojoynt, Triluron, TriVisc, Visco-3 are hyaluronan derivatives that are injected into the knee joints to increase the elastoviscous properties of arthritic joint fluid and slow its outflow from the joint . The goal of therapy is torestore the viscoelasticity in the affected joints, thereby decreasing pain, improving mobility, and restoring the natural protective functions (1).The American College of Rheumatology (ACR) updated its guidelines for the treatment of osteoarthritis (OA) of the knee in 2012. In mild symptomatic OA, treatment may be limited toFederal Employee Program® 1310 G Street, N.W.Washington, D.C. 20005 202.942.1000Fax 202.942.1125Section: Prescription Drugs Effective Date: April 1, 2020 Subsection: Neuromuscular Drugs Original Policy Date: June 9, 2011 Subject: Hyaluronic Acid Derivatives Page: 2 of 7patient education, physical and occupational therapy and other non-pharmacologic modalities. Nonpharmacologic modalities strongly recommended for the management of knee OA were aerobic, aquatic, and/or resistance exercises as well as weight loss for overweight patients. Nonpharmacologic modalities conditionally recommended for knee OA included medial wedge insoles for valgus knee OA, subtalar strapped lateral insoles for varus knee OA, medially directed patellar taping, manual therapy, walking aids, thermal agents, tai chi, self-management programs, and psychosocial interventions. Pharmacologic modalities conditionally recommended for the initial management of patients with knee OA included acetaminophen, oral and topical NSAIDs, tramadol, and intraarticular corticosteroid injections (1).Regulatory StatusFDA-approved indication: Hyaluronic acid derivatives are indicated for the treatment of pain in osteoarthritis (OA) of the knee in patients who have failed to respond adequately to conservative non-pharmacologic therapy, simple analgesics (e.g., acetaminophen), NSAIDs, tramadol, or intra-articular steroid injections (2-18).The hyaluronic acid derivatives are contraindicated for use in patients with known hypersensitivity to hyaluronan (sodium hyaluronate) preparations. Orthovisc lists hypersensitivity to gram positive bacterial proteins as an additional contraindication (4). Caution should be exercised when Gel-One, Hyalgan, Visco-3, Synvisc, Synvisc-One, Supartz, and Triluron are administered to patients with allergies to avian proteins, feathers, and egg products (3-8, 18).Hyaluronic acid derivatives are contraindicated to treat patients with knee joint infections, infections or skin diseases in the area of the injection site (2-17).A treatment cycle for most of the hyaluronan derivatives typically involves multiple weekly injections. Euflexxa, GelSyn-3, Sodium Hyaluronate, Synvisc, Triluron, TriVisc, and Visco-3 are given for a total of three injections. Orthovisc is given for three or four injections. GenVisc 850, Supartz and Hyalgan are given for a total of three or five injections. Durolane, Gel-One, Synojoynt, and Synvisc-One differ from the other hyaluronan derivatives in that it only requires one injection. Repeat courses of hyaluronan derivatives may be administered if symptoms return (2-18).Upon the basis of high quality supporting evidence, the American Academy of Orthopedic Surgeons cannot recommend using hyaluronic acid for patients with symptomatic osteoarthritis of the knee (19).Related policiesSection: Prescription Drugs Effective Date: April 1, 2020 Subsection: Neuromuscular Drugs Original Policy Date: June 9, 2011 Subject: Hyaluronic Acid Derivatives Page: 3 of 7Hyaluronate PowderPolicyThis policy statement applies to clinical review performed for pre-service (Prior Approval, Precertification, Advanced Benefit Determination, etc.) and/or post-service claims.Hyaluronic acid derivatives may be considered medically necessary for the treatment of osteoarthritis of the knee and if the conditions indicated below are met.Hyaluronic acid derivatives may be considered investigational for all other indications.Prior-Approval RequirementsAge18 years or older (22 or older for Synvisc, Synvisc-One, and TriVisc)DiagnosisPatient must have the following:Osteoarthritis of the kneeAND ALL of the following:1. Inadequate response to TWO or more of the following conservative non-pharmacologic therapy:a. Cardiovascular (aerobic) activity, such as: walking, biking, stationarybike, aquatic exerciseb. Resistance exercisec. Weight reduction (for persons who are overweight)d. Participation in self-management programse. Wear of medially directed patellar tapingf. Wear of wedged insolesg. Thermal agentsh. Walking aidsi. Physical therapyj. Occupational therapy2. Inadequate response, intolerance, or contraindication to TWO or more of thefollowing:Section: Prescription Drugs Effective Date: April 1, 2020 Subsection: Neuromuscular Drugs Original Policy Date: June 9, 2011 Subject: Hyaluronic Acid Derivatives Page: 4 of 7a. Acetaminophenb. Oral NSAIDsc. Topical NSAIDs3. Inadequate response, intolerance, or contraindication to intra-articularsteroid injections in which efficacy lasted less than 8 weeks4. Radiologic confirmation of Kellgren-Lawrence Scale score of grade 2 orgreater5. NO dual therapy with another hyaluronic acid injectable6. Non-preferred medications only: Patient MUST have tried at least TWO ofthe preferred products unless the patient has a valid medical exception (e.g.inadequate treatment response, intolerance, contraindication)Prior – Approval Renewal RequirementsAge18 years or older (22 or older for Synvisc, Synvisc-One, and TriVisc)DiagnosisPatient must have the following:Osteoarthritis of the kneeAND ALL of the following:1. Documentation of improvement in pain with previous course of treatment2. At least 12 months has elapsed since last injection of the prior treatmentcycle3. Documentation of reduction of dosing of NSAIDs or other analgesicsduring the 12 month period following the last injection of the prior treatmentcycle4. NO dual therapy with another hyaluronic acid injectable5. Non-preferred medications only: Patient MUST have tried at least TWOof the preferred products unless the patient has a valid medical exception(e.g. inadequate treatment response, intolerance, contraindication) Policy GuidelinesPre - PA AllowanceNoneSection: Prescription Drugs Effective Date: April 1, 2020 Subsection: Neuromuscular Drugs Original Policy Date: June 9, 2011 Subject: Hyaluronic Acid Derivatives Page: 5 of 7Prior - Approval LimitsDuration12 monthsQuantity One course of therapy for each kneePrior – Approval Renewal LimitsSame as aboveRationaleSummaryOsteoarthritis of the knee is a disease in which the elastoviscous property of the synovial fluid in the knee joint becomes diminished, resulting in less protection and shock absorption. Durolane, Euflexxa, Gel-One, GelSyn-3, GenVisc 850, Hyalgan, Hymovis, Monovisc, Orthovisc, Sodium Hyaluronate, Synvisc, Synvisc-One, Supartz, Synojoynt, Triluron, TriVisc, Visco-3 are hyaluronan derivatives that are injected into the knee joints to increase the elastoviscous properties of arthritic joint fluid and slow its outflow from the joint. The goal of therapy is to restore the viscoelasticity in the affected joints, thereby decreasing pain, improving mobility, and restoring the natural protective functions (1-18).Prior approval is required to ensure the safe, clinically appropriate and cost effective use of the hyaluronic acid derivatives while maintaining optimal therapeutic outcomes.References1. American College of Rheumatology, Subcommittee on Osteoarthritis Guidelines.Recommendations for the medical management of osteoarthritis of the hip and knee:2012 update. Arthritis Care & Research 2012; 64(4):465-474.2. Euflexxa [package insert]. Parsippany, NJ: Ferring Pharmaceuticals Inc.; July 2016.3. Hyalgan [package insert]. Parsippany, NJ: Fidia Pharma USA Inc.; May 2014.4. Orthovisc [package insert]. Woburn, MA: Anika Therapeutics; June 2005.5. Supartz [package insert]. Durham, NC: Bioventus LLC; April 2015.6. Synvisc [package insert]. Ridgefield, NJ: Genzyme Corp.; December 2014.7. Synvisc-One [package insert]. Ridgefield, NJ: Genzyme Corp.; September 2014;8. Gel-One [package insert]. Warsaw, IN: Zimmer Inc.; May 2011.9. Monovisc [package insert]. Bedford, MA: Anika Therapeutics; December 2013.10. Hymovis [package insert]. Parsippany, NJ: O Fidia Pharma USA Inc.; October 2015.Section: Prescription Drugs Effective Date: April 1, 2020 Subsection: Neuromuscular Drugs Original Policy Date: June 9, 2011 Subject: Hyaluronic Acid Derivatives Page: 6 of 711. GenVisc 850 [package insert]. Doylestown, PA: OrthogenRx Inc.; January 2015.12. GelSyn-3 [package insert]. Durham, NC: Bioventus LLC; January 2016.13. Durolane [package insert]. Durham, NC: Bioventus LLC; November 2017.14. Visco-3 [package insert]. Warsaw, IN: Zimmer, Inc.; May 2017.15. Sodium Hyaluronate [package insert]. North Wales, PA: Teva Pharmaceuticals USA,Inc.; March 2019.16. Synojoynt [package insert]. North Wales, PA: Teva Pharmaceuticals USA, Inc.;September 2019.17. TriVisc [package insert]. Doylestown, PA: OrthogenRx, Inc.; September 2018.18. Triluron [package insert]. Florham Park, NJ: Fidia Pharma USA Inc.; March 2019.19. American Academy of Orthopaedic Surgeons. Treatment of osteoarthritis of the knee.Evidence-based guideline 2nd edition. May 2013.Policy HistoryDate Action ReasonJanuary 2012 Added minimum age - only approved for adultsDecember 2012 Annual editorial review and reference updateDecember 2013 Annual editorial review and reference updateMarch 2014 Annual editorial reviewAddition of examples of non-pharmacological agents and agents of priorfailure medications.April 2014 Line-Addition of Monovisc to PAMarch 2015 Annual criteria review and reference updateMarch 2016 Change from one tried and failed to two tried and failed non-pharmacologic and pharmacologic therapies and addition of the tried and failed of intra-articular steroid and radiologic confirmation of Kellgren-Lawrence Scalescore of grade 2 or greaterAddition of HymovisPolicy # change from 5.11.04 to 5.75.09May 2016 Addition of GelSyn-3 and GenVisc 850December 2016 Annual editorial review and reference updateAdded: no dual therapy with another hyaluronic acid injectableMarch 2017 Bolded preferred products in the title pageJuly 2017 GelSyn-3 has been changed to preferredSeptember 2017 Annual reviewDecember 2017 Addition of Durolane and Visco-3March 2018 Annual editorial reviewRemoval of Tramadol from the T/F listSeptember 2019 Annual review and reference update. Addition of Sodium Hyaluronate,Synojoynt, and TriViscSection: Prescription Drugs Effective Date: April 1, 2020 Subsection: Neuromuscular Drugs Original Policy Date: June 9, 2011 Subject: Hyaluronic Acid Derivatives Page: 7 of 7December 2019 Annual review. Addition of requirement to trial preferred products January 2020 Addition of TriluronMarch 2020 Annual reviewKeywordsThis policy was approved by the FEP® Pharmacy and Medical Policy Committee on March 13, 2020 and is effective on April 1, 2020.。

CryoStor®CS2, CS5, and CS10 CryopreservationMediaCatalog Numbers C3124, C2999, and C2874Storage Temperature 2–8 °CTECHNICAL BULLETINProduct DescriptionThe CryoStor®CS2, CS5, and CS10 family of preservation solutions represents the next generation of cryopreservation media. Designed to prepare and preserve cells in ultra low temperature environments (–80 to –196 °C), CryoStor media provide a safe, protective environment for cells and tissues during the freezing, storage, and thawing process. Through modulating the cellular biochemical response to the cryopreservation process, these media provide enhanced cell viability and functionality, while eliminating the need to include serum, proteins, or high levels of cytotoxic agents.CryoStor CS2, CS5, and CS10 are a series of cell-specific, optimized preservation media, uniquely formulated to address the molecular biological aspects of cells during the cryopreservation process; thereby, directly reducing the level of Cryopreservation-Induced Delayed-Onset Cell Death and improving post-thaw cell viability and function.These media are recommended for the preservation of stem cells, hepatocytes, tissue samples, and other extremely sensitive cell types.ReagentsCryoStor CS2 (Catalog Number C3124), CS5 (Catalog Number C2999), and CS10 (Catalog Number C2874) are uniquely formulated cryopreservation media containing 2%, 5%, and 10% DMSO, respectively. Precautions and DisclaimerThis product is for R&D use only, not for drug, household, or other uses.Please consult the Material Safety Data Sheet for information regarding hazards and safe handling practices. Preparation InstructionsThe CryoStor media are ready-to-use and complete with no additives required.Wipe down the outside of container with a 70% ethanol solution before opening as the contents are sterile. If the tamper evident seal has been broken, do not use. Storage/StabilityStore the CryoStor media at 2–8 °C and protected from light until ready to use.ProcedureCryopreservation with CryoStor Media1.Suspend cells to be cryopreserved usingmechanical or enzymatic dissociation.2.Centrifuge cells to obtain cell pellet.3.Remove supernatant.Note: Remove as much culture medium as possible to reduce dilution of the CryoStor medium.4.Isolation -Add cold (2–8 °C) CryoStor medium toa cell concentration range of 0.5–10 ×106cells/mlfor standard cell culture protocols. A higher cellconcentration is possible with testing.Note: CryoStor media contain DMSO, no additives are necessary.5.Pre-freeze -Incubate cell suspension at 2–8 °C for∼10 minutes.6.Nucleation –Lower sample temperature to –80 °C.e a controlled rate freezer (–1 °C/minute) orsimilar procedure for most mammalian cellsystems.b.The freezer should be pre-cooled to 2–8 °C.c.Ice nucleation within the sample (seeding)should be initiated at approximately –5 °C usinga liquid nitrogen burst program setting on thecontrolled rate freezer or mechanical agitation(flick or tap) of the cryovial/sample containerafter 15–20 minutes at –80 °C.Alternative Nucleation Procedures –cells can befrozen using stepwise freezing procedures.Stepwise freezing procedures include:a. 2 hours at –20 °C followed by 2 hoursat –80 °C.orb.3–4 hours at –80 °C in an isopropanol freezingcontainer. The isopropanol container should bepre-cooled to 2–8 °CIce nucleation -mechanical agitation (flick or tap) of the cryovial/sample container after 15–20 minutesat –80 °C.7.Storage –Store the samples at liquid nitrogentemperatures (below –130 °C).Note: Sample storage at –80 °C is onlyrecommended for short-term storage (weeks tomonths).8.Thawing -Thaw samples quickly in a 37 °C waterbath. Sample should be thawed with gentle swirling of the sample until all visible ice has melted. Thaw time for a 1 ml sample in a cryovial is ∼3 minutes.Note: DO NOT allow sample to warm above chilled temperatures (0–10 °C). Cryovials should be coolto the touch when removed from the water bath.Passive thaw is not recommended.9.Dilute cell/CryoStor mixture immediately withappropriate culture medium. This can be performed in a single step. The dilution medium should bebetween 20–37 °C. A dilution ratio of 1:10(sample:medium) or greater is recommended.10.Plate cells appropriately.11.Culture the cells or use immediately.ResultsViability assessment 24-hours post-thaw -Live/Dead fluorescent assays or metabolic assays (MTT or resazurin) are recommended for more accurate viability assessment. Visual inspection of adherent cells and cells “floating” in the medium is also recommended. Notes: Sample assessment immediately post-thaw with membrane integrity indicators, such as trypan blue for comparative analysis of sample cell yield and viability often results in significant overestimates of cell survival. To obtain an accurate measure of cell viability following cryopreservation, assessment should be performed24 hours post-thaw and compared to non-frozen controls.CryoStor is a registered trademark of BioLife Solutions, Inc.DF,JF,MAM 11/10-1Sigma brand products are sold through Sigma-Aldrich, Inc.Sigma-Aldrich, Inc. warrants that its products conform to the information contained in this and other Sigma-Aldrich publications. Purchaser must determine the suitability of the product(s) for their particular use. Additional terms and conditions may apply. Please see reverse side ofthe invoice or packing slip.。

© WIV, CAS and Springer-Verlag Berlin Heidelberg 2014D ECEMBER 2014　V OLUME 29　I SSUE 6　403R ESEARCH ARTICLEGeneration of Hepatitis B virus PreS2-S antigen in Hansenula polymorphaXiaowei Xu 1,2, Sulin Ren 2, Xiaoxiao Chen 2, Jun Ge 2, Zhenxing Xu 2, Hongying Huang 2, Honglin Sun 2, Yue Gu 2, Tong Zhou 2, Jianqiang Li 2✉, Hanmei Xu 1✉1. State Key Laboratory of Nature Medicines, China Pharmaceutical University, Nanjing 210009, China2. Institute of Vaccine Research, Jiangsu Simcere Pharmaceutical Group, Nanjing 210042, ChinaDespite the long availability of a traditional prophylactic vaccine containing the HBV surface antigen (HBsAg) and aluminum adjuvant, nearly 10% of the population remains unable to generate an effective immune response. Previous studies have indicated that hepatitis B virus (HBV) PreS2-S is abundant in T/B cell epitopes, which induces a stronger immune response than HBsAg, particularly in terms of cytotoxic T lymphocyte (CTL) reaction. In the current study, the HBV PreS2-S gene encoding an extra 26 amino acids (PreS2 C-terminus) located at the N-terminus of HBsAg was cloned into the pVCH1300 expression vector. PreS2-S expressed in the methylotrophic yeast, Hansenula polymorpha , was produced at a yield of up to 250 mg/L. Subsequent puri fi cation steps involved hydrophobic adsorption to colloidal silica, ion-exchange chromatography and density ultracentrifugation. The fi nal product was obtained with a total yield of ~15% and purity of ~99%. In keeping with previous studies, ~22 nm virus-like particles were detected using electron microscopy. The generated PreS2-S antigen will be further studied for ef fi cacy and safty in animals. KEYWORDS hepatitis B virus (HBV); PreS2-S; virus-like particle (VLP); Hansenula polymorphaReceived: 27 September 2014, Accepted: 15 December 2014Published online: 24 December 2014✉ Correspondence:Jianqiang Li: Phone: +86-25-85560000 (Ext: 3052), Email:************************Hanmei Xu: Phone: +86-25-86185437,Email:139****************VIROLOGICA SINICA 2014, 29 (6): 403-409DOI 10.1007/s12250-014-3508-9I NTRODUCTION Hepatitis B virus belongs to hepadnaviridae , a family of enveloped viruses containing a partially double-stranded and circular DNA genome (G. Birkenmeyer L, 2003). Records show that more than 350 million people world-wide are infected by this virus (Awan A R, et al., 2012). Clinical antiviral therapies currently used for chronic hepatitis B infection often lead to drug tolerance and are unable to eradicate the virus completely (Janssen H L, et al., 2005; Liaw Y F, et al., 2000; Niederau C, et al., 1996). Although an effective prophylactic vaccine has been available for nearly 30 years to date, up to 10%of individuals do not experience a response with anadequate antibody level to hepatitis B surface antigen (Sjogren M H, 2005). Therefore, development of a novel hepatitis B vaccine with a better penetrating and a higher response rate is essential.The HBV envelope consists of three major immuno-genic proteins, known as large (PreS1-PreS2-S), medium (PreS2-S) and small protein (HBsAg), and is the main component of the currently licensed recombinant prophy-lactic vaccine (Hadiji-Abbes N, et al., 2009). Previous studies have suggested that the PreS2-S region has the strongest immunogenicity, which could enhance anti-body response to HBsAg and thus mitigate the chance of non-responsiveness of vaccines against escape variants, making it the most suitable candidate antigen for a novel HBV vaccine (Hadiji-Abbes N, et al., 2009). However, the entire PreS2 region containing 55 amino acids is sen-sitive to protease degradation, which makes large-scale preparation difficult (Langley K E, et al., 1988). The C-terminus of PreS2 containing 26 amino acids (120-145 aa) has been shown to be the most effective immu-Hepatitis B Virus PreS2-S VLP generationVIROLOGICA SINICA404　D ECEMBER 2014　V OLUME 29　I SSUE6nogen for production of antisera and has been proposed to contain a conserved conformational epitope critical for neutralization of infection (Chi S W, et al., 2006). Moreover, PreS2 containing 26 amino acids (120-145 aa) appears more stable than PreS2 containing 55 amino acids. Therefore, a truncated PreS2-S protein comprising 120-145 aa of the PreS2 (26 aa) C-terminus and entire HBsAg was used in the current study.The methylotrophic yeast Hansenula polymorpha (H. polymorpha ), a highly ef fi cient microbial cell factory, has been successfully used in the production of several cur-rent commercial prophylactic HBV vaccines (Gellissen G, et al., 1992; Huang Y, et al., 2007). Here, H. poly-morpha was employed as the host strain to express HBV PresS2-S, leading to a production yield of up to 250 mg per liter. After several steps of puri fi cation, total yield of ~15% with ~99% purity was obtained. Consistent with previous findings, ~22 nm virus-like particles were de-tected using electron microscopy. MATERIALS AND METHODSStrains and reagentsH. polymorpha DL-1 (ATCC 26012) was purchased from ATCC, Geneticin TM (G418) from Invitrogen (Life Technologies, California, USA), the PCR cloning kit from Toyobo (Toyobo, Osaka, Japan) and CsCl from Sigma Aldrich (Sigma Aldrich, Missouri, USA). Eco R I , Not I , Bgl II were purchased from Takara (Takara Bio Inc., Otsu, Japan).Plasmid construction and protein expression The codon-optimized coding sequence of adw2-sub-type HBV PreS2-S antigen (containing 26 aa of PreS2 C-terminus) was amplified from pVAC1010-PreS2-S (plasmid stored in our laboratory). Briefly, the PreS2-S was amplified by KOD plus kit according to the manufacturer’s instructions using primer M26-F: CCGGAATTCGACATGGGTACAGTTAGTC (Eco R I) and primer M-R: ATAGTTTAGCGGCCGCTTAAATGT (Not I). The ampli fi ed coding sequence was subsequent-ly digested with Eco R I, Not I and inserted into the expression vector, pVCH1300. The resultant plasmid was sequenced by GENEWIZ, Inc (Suzhou, China). For yeast transformation, plasmid pV CH1300-PreS2-S was linearized with the restriction endonuclease Bgl II and transformed into H. polymorpha according to the method described by Faber et al. (1994). Positive clones were cultured in BMGY or YPD medium at 220 rpm/min, 37ºC, for 1 day and induced using 1% (w/v) methanol f o r 48 h. Protein puri fi cationHarvested cells was re-suspended in sodium phos-phate buffer (50 mmol/L PB, 150 mmol/L NaCl, pH8.0) and disrupted with a high-pressure homogenizer at 4 ºC (1500 bar, 4 ). The cell debris was removed via centrifugation at 4 ºC, 4,400 g , for 15 min and the super-natant mixed with colloidal silica Aerosil-380 (Evonik Degussa, Essen, Germany ), which was pre-equilibrated in 25 mmol/L sodium phosphate buffer, 0.5 mol/L NaCl, pH 7.2. The suspension was stirred at 4 ºC for 4 h and centrifuged at 4 ºC, 7500 g , for 30 min. The pellet was washed with 25 mmol/L sodium phosphate buffer, pH 7.2, and centrifuged as above. The resultant pellet was re-suspended in 100 mmol/L sodium carbonate-bicarbon-ate buffer (pH 10.8) and incubated at 37 ºC for 4 h. The suspension was centrifuged at 25 ºC, 10,000 rpm, for 1 h. The clari fi ed supernatant was adjusted to pH 8.0 and processed using ion-exchange chromatography (DEAE Sepharose FF, GE Healthcare). Bound PreS2-S was eluted using a salt step (50 mmol/L Tris-HCl buffer, pH 8.0, 0-1 mol/L NaCl). PreS2-S-containing fractions were pooled and further separated via CsCl density gradient centrifu-gation (Beckman, California, USA) at 36,000 rpm and 4 ºC for 16 h.Quantitative measurement of PreS2-S using ELISAThe PreS2-S concentration in the crude extract was determined using a commercially available ELISA kit (Kehua Bio-engineering, Shanghai, China). Purified PreS2-S was employed to establish a standard curve. Crude yeast extract containing PreS2-S was diluted appropriately with 0.1% BSA in PBS (pH 7.2) and ap-plied for ELISA. The resultant absorption values were converted to PreS2-S concentrations using the standard curve established above. All samples were analyzed in triplicate.Silver staining and Western BlotThe protein sample was separated using 12% SDS-PAGE and characterized via silver staining acc ording to the manual of Novex (Life Technologies, California, USA). Western blot analysis was carried out us-ing mouse anti-human HBsAg polyclonal antibody (ABMAX, Beijing, China) and HRP-conjugated goat anti-Mice IgG antibodies (Sigma Aldrich, Missouri,USA ). Brie fly, NC membrane was incubated with pri-mary antibody (1:1000 dilution) in 5% blocking solu-tion at 37°C for 40 min. After washing with TBST, the membrane was incubated with HRP-conjugated second-ary antibody (1:10000 dilution) in 5% blocking buffer at 37°C for 30 min. Signal detection was performed using Western Lightning® Plus-ECL (PerkinElmer. Inc, Massachusetts, USA )Electron Microscopy T h e structure of PreS2-S virus-like particles was con-Xiaowei Xu et al D ECEMBER 2014　V OLUME 29　I SSUE 6　405fi rmed using transmission electron microscopy (HT7700, Hitachi). Purified samples were applied to a 400-mesh copper grid, dried, and stained with 2% tungstophosphor-ic acid before TEM observation. The particle size was measured using Image J software.RESULTSPlasmid constructionThe coding sequence of the adw2-subtype HBV PreS2-S antigen (containing 26 amino acids of the PreS2 C-terminus, 120-145 aa) was optimized according to the codon bias of H. polymorpha (Figure 1A ). The op-timized sequence was ampli fi ed and further cloned into the expression vector, pVCH1300, under the control of the strong methanol-inducing MOX promoter (Figure 1B and 1C ). A geneticin (G418) resistance gene was used as a positive selection marker. The resultant plasmid was veri fi ed using colony PCR and restriction enzyme ana l y-sis (Figure 1D ).Expression of PreS2-SThe plasmid was transformed into H. polymorpha cells using a previously published method (Faber K N, et al.,1994). Multiple copy inserts were screened according to protocols of the Invitrogen manual and further con fi rmed using rea1-time PCR (data not shown). The resultant multiple copy colonies were cultured in YPD medium and induced with methanol at a fi nal concentration of 1% (Figure 2A and 2B ). Induced samples were collected at the indicated time-points and characterized using Western blot (Figure 2C ). After two days of methanol induction, the expression yield was estimated as 250 mg/L culture (2.5 mg/g wet cells).Puri fi cation of HBV PreS2-SHarvested cells was re-suspended in sodium phosphate buffer and disrupted using a high-pressure homogenizer. After clarification via centrifugation at 4,400 g for 15 min, the supernatant containing HBsAg was further clari-fi ed with colloidal silica. The salt steps in the puri fi cation of PreS2-S protein using DEAE Sepharose FF chroma-tography are presented in Figure 3A . The SDS-PAGE pattern (Figure 3B ) showed that the fraction eluted with buffer (50 mmol/L Tris-HCl pH 8.0 plus 500 mmol/L NaCl) mainly contained the monomer and polymer forms of the desired protein and no other evident bands of host protein. PreS2-S-containing fractions were pooled, fur-Figure 1. A: Schematic representation of the truncated PreS2-S. B: Construct of plasmid (pVCH1300-PreS2-S) used to produce Hepatitis B PreS2-S in H. polymorpha. C: The coding sequence of PreS2-S was ampli fi ed byPCR. D: Restriction enzyme analysis of pVCH1300-PreS2-S.Hepatitis B Virus PreS2-S VLP generationVIROLOGICA SINICA406　D ECEMBER 2014　V OLUME 29　I SSUE6ther separated via CsCl density gradient centrifugation, and analyzed via Western Blot. We observed enrichment of PreS2-S mainly in fractions 7-8 (~1.18 g/mL) (Figure 3C ). The final product, with a total yield of ~15% and purity of 99%, was quanti fi ed using ELISA, as described above.Electron Microscopy fi ndingsHBsAg needs to assemble into spherical particles, so-called virus-like particles (VLPs), to initiate the re-quired protective immune response (Cabral G A, et al., 1978). To establish whether PreS2 is able to assemble into VLPs, transmission electron microscopy was per-formed. The hepatitis B PreS2-S antigen derived from H. polymorpha cells organized into 22.6±3.0 (n =32) nm virus-like particles (Figure 4A and 4B ), which were morphologically similar to those isolated from S a ccharomyces cerevisiae and Pichia pastoris . DISCUSSIONHepatitis B virus (HBV) infection is the main cause ofcirrhosis and hepatocellular cancer (Torbenson M, et al., 2002). The currently available recombinant prophylactic vaccine for HBV, either expressed in Chinese hamster ovary (CHO) cells or yeast, can induce effective humoral responses (Chen H, et al., 2012). However, up to 10% of individuals are still unable to experience a response with an adequate protective antibody level to hepatitis B surface antigen (Sjogren M H, 2005). Therefore, there remains an urgent requirement for a novel hepatitis B vaccine with a better penetrating and response rate.The HBV envelope consists of three major immuno-genic proteins, known as large (PreS1-PreS2-S), medi-um (PreS2-S) and small protein (HBsAg), respectively. The PreS2-S region has the strongest immunogenicity, which could accelerate antibody response to HBsAg and thus lower the chance of non-responsiveness of vaccines against escape variants (Hadiji-Abbes N, et al., 2009). Moreover, the PreS2 region contains a conserved polym-erized albumin receptor site involved in virus attachment to human hepatocytes, and anti-PreS2 antibodies often arise earlier than anti-HBsAg antibodies (Kuroda S, et al., 1991; Milich D R, et al., 1985).Figure 2. pVCH1300-PreS2-S transformed H. polymorpha cells growth curves before (A) and after methanolinduction (B). Samples inducing at indicated time points were characterized by Western-Blot (C).Xiaowei Xu et alFigure 3. Purification of HBVPreS2-S from H. polymorphacells. A: Elution profi le of DEAEchromatography. B: Eluate ofDEAE chromatography wascharacterized by Silver Stain-ing. C: Fractions from CsCldensity gradient centrifugationwere analyzed by Western Blot.Figure 4. A: Electron micrograph ofpurified Hepatitis B PreS2-S VLPsderived from H. polymorpha cells. B:Particle size of Hepatitis B PreS2-SVLPs. D ECEMBER 2014　V OLUME 29　I SSUE 6　407Hepatitis B Virus PreS2-S VLP generationVIROLOGICA SINICA408　D ECEMBER 2014　V OLUME 29　I SSUE6However, PreS2-S was comparatively unstable and easily degraded in our previous experiments (data no shown), consistent with other reports (Lian M, et al., 2008). Therefore, a truncated PreS2-S protein compris-ing the C-terminus of PreS2 (120-145 amino acids, 26 aa) and entire HBsAg was used in this study. Vaccines containing PreS2 can compete with HBV and block the route of infection, implying that PreS2 is a potential can-didate component of novel HBV vaccines (Jiang Z G, et al., 2007).The methylotrophic yeast, H. polymorpha , is a highly ef fi cient microbial cell factory (Gellissen G, et al., 1992). Here, a PreS2(26 aa)-S truncated gene was cloned into pVCH1300 and transformed into H. polymorpha DL-1. High dose G418-resistant colonies were screened and confirmed via real-time quantitative PCR. Remarkably, nearly 60 copies of plasmid were integrated into the ge-nome of H. polymorpha DL-1 cells and transferred stably in progeny (data not shown), which possibly contributed to the significant production of foreign proteins. In our experiments, PreS2-S production yield in H. polymorpha cells was up to 250 mg per liter. Additionally, the gen-eration process was more productive and cost-effective. After several steps of puri fi cation, a total yield of ~15% with ~99% purity was obtained, which was significantly higher than that from Pichia pastoris (Hardy E, et al., 2000). As a prerequisite for initiating the protective immune response, the ability to assemble into ~22 nm virus-like particles of PreS2-S antigen derived from H. polymorpha cells was con fi rmed using electron micros-copy (Cabral G A, et al., 1978). To our knowledge, this is the fi rst report of intracellular expression of PreS2-S VLPs in H. polymorpha. Further animal immunization studies with this antigen are required to fully evaluate PreS2-S as a potential vaccine candidate. Efficacy and safety studies will be reported in future publications.ACKNOWLEDGMENTSWe are grateful to our colleagues for sharing their re-sults during scienti fi c meetings and informal discussions. The Jiangsu Simcere Pharmaceutical Group has propri-etary interests in the hepatitis B prophylactic and thera-peutic vaccines described in this study.COMPLIANCE WITH ETHICS GUIDELINES All authors declare no competing interests. This article does not contain studies with human or animal subjects.AUTHOR CONTRIBUTIONSJL and HX designed the experiments. XX, SR, XC, JG, ZX, HH, HS, YG and TZ performed the experiments.XX, SR and JL analyzed data. XX and SR wrote the pa-per. All authors read and approved the fi nal manuscript.REFERENCESA w an A R, Zahoor M Y , Javed M M, Babar M E, Saleem Z. 2012. Expression of pres2/S antigen of hepatitisB virus isolated from Pakistan in yeast cells. Pak. J. Bot., 44: 355–359.C a bral G A, Marciano-Cabral F, Funk G A, Sanchez Y , Hollinger F B, Melnick J L, Dreesman G R. 1978. Cellular and humoral immunity in guinea pigs to two major polypeptides derived from hepatitis B surface antigen. J Gen Virol, 38: 339–350.C h en H, Chuai X, Deng Y, Wen B, Wang W, Xiong S, Ruan L, Tan W. 2012. Optimisation of prime-boost immunization in mice using novel protein-based and recombinant vaccinia (Tian-tan)-based HBV vaccine. PLoS One, 7: e43730.C h i S W, KimD H, Kim J S, Lee M K, Han K H. 2006. Solution conformation of an immunodominant epitope in the hepatitis B virus preS2 surface antigen. Antiviral Res, 72: 207–215.F aber K N, Haima P, Harder W, Veenhuis M, Ab G. 1994. High-ly-ef fi cient electrotransformation of the yeast Hansenula poly-morpha. Curr Genet, 25: 305–310.G . Birkenmeyer L. 2003. Hepatitis B virus: life cycle and mor-phogenesis. In: Ias K M (ed.), Perspectives in Medical Virology, vol. V olume 10. Elsevier, p109–125.G ellissen G, Janowicz Z A, Weydemann U, Melber K, Strasser A W, Hollenberg C P. 1992. High-level expression of foreign genes in Hansenula polymorpha. Biotechnol Adv, 10: 179–189.H adiji-Abbes N, Borchani-Chabchoub I, Triki H, Ellouz R, Gar-gouri A, Mokdad-Gargouri R. 2009. Expression of HBsAg and preS2-S protein in different yeast based system: a comparative analysis. Protein Expr Purif, 66: 131–137.H ardy E, Martinez E, Diago D, Diaz R, Gonzalez D, Herrera L. 2000. Large-scale production of recombinant hepatitis B surface antigen from Pichia pastoris. J Biotechnol, 77: 157–167.H uang Y , Bi J, Zhang Y , Zhou W, Li Y , Zhao L, Su Z. 2007. A highly ef fi cient integrated chromatographic procedure for the puri fi ca-tion of recombinant hepatitis B surface antigen from Hansenula polymorpha. Protein Expr Purif, 56: 301–310.J anssen H L, van Zonneveld M, Senturk H, Zeuzem S, Akarca U S, Cakaloglu Y , Simon C, So T M, Gerken G, de Man R A, Niesters H G, Zondervan P, Hansen B, Schalm S W. 2005. Pe-gylated interferon alfa-2b alone or in combination with lamivu-dine for HBeAg-positive chronic hepatitis B: a randomised trial. Lancet, 365: 123–129.K uroda S, Fujisawa Y , Iino S, Akahane Y , Suzuki H. 1991. Induction of protection level of anti-pre-S2 antibodies in humans immunized with a novel hepatitis B vaccine consisting of M (pre-S2 + S) pro-tein particles (a third generation vaccine). V accine, 9: 163–169.L angley K E, Egan K M, Barendt J M, Parker C G, Bitter G A. 1988. Characterization of purified hepatitis B surface antigen containing pre-S(2) epitopes expressed in Saccharomyces cere-visiae. Gene, 67: 229–245.L ian M, Zhou X, Chen B, Li C, Gu X, Luo M, Zheng X. 2008. Identi fi cation of the critical regions in hepatitis B virus preS re-quired for its stability. J Pept Sci, 14: 307–312.L iaw Y F, Leung N W, Chang T T, Guan R, Tai D I, Ng K Y , Chien R N, Dent J, Roman L, Edmundson S, Lai C L. 2000. Effects of extended lamivudine therapy in Asian patients with chronic hepatitis B. Asia Hepatitis Lamivudine Study Group. Gastroen-terology, 119: 172–180.M ilich D R, Thornton G B, Neurath A R, Kent S B, Michel M L, Tiollais P, Chisari F V . 1985. Enhanced immunogenicity of the pre-S region of hepatitis B surface antigen. Science, 228: 1195–Xiaowei Xu et al D ECEMBER 2014　V OLUME 29　I SSUE 6　4091199. N iederau C, Heintges T, Lange S, Goldmann G, Niederau C M, Mohr L, Haussinger D. 1996. Long-term follow-up of HBeAg-positive patients treated with interferon alfa for chronic hepatitis B. N Engl J Med, 334: 1422–1427.S jogren M H. 2005. Prevention of hepatitis B in nonresponders to initial hepatitis B virus vaccination. Am J Med, 118 Suppl 10A:34S–39S.T orbenson M, Thomas D L. 2002. Occult hepatitis B. Lancet In-fect Dis, 2: 479–486.J iang Z G, Wang Y , Shao X A, Yue Y , Hong X W, Xu L, Xiong S D. 2007. Antibodized gene vaccine harboring to HBV PreS2/S gene can enhance HBV speci fi c CTL response induced by gene immunization. Chinese J Immunol, 963–967. (In Chinese)。

STH-15S supervised speakersSTH-15SR (Red)SHMP-R Adapter plateDescriptionThe Wheelock STH-15S supervised hornloudspeakers are equipped with a compression driver providing up to 15 watts RMS power handling capability, superior intelligibility and dispersion to achieve maximum sound projection and penetration.Weather-resistant metal construction and reentrant acoustic path assure protection against water, humidity and corrosion. The mounting bracket allows directional sound dispersion viavertical and horizontal positioning. Provisions are also included for surface or strap mounting to pillars and I-beams.All models include a built-in 25/70 Vtransformer featuring a screwdriver adjustable, 7-position watt/impedance selection switch. Wiring terminals are protected with a vandal-resistant adapter cover for control equipment utilizing cable or conduit.A built-in 5 uF capacitor is provided on both models for line supervision.All models meet or exceed the UL Listed standards for audible signal appliances and are capable of operating within an ambient temperature range of 150° F (66° C) to –31° F (–35° C). Models comply with UL Standard 1480—Speakers for Fire Protective Signaling Systems and California State Fire Marshal (Title 19).Specifications: General•Disperson angle: 70 Degrees (–6 dB @ 2,000 Hz octave band)Specifications: UL Rating• Power rating: 15 Watt continuous• Frequency response: 400–4,000 Hz (nominal)•Sensitivity: 101 dB @ 15 Watts @ 10 ft.ApplicationsThe Wheelock STH-15S supervised hornloudspeakers are surface-mounting, high-efficiency units for life safety and communication system applications. When used with compatible control equipment, they provide high-intelligibility voice reproduction and signal transmission for indoor or outdoor emergency alarm and protective signaling.Features & benefits•Approvals include UL Standard 1480–Speakers for Fire Protective Signaling Systems, California State Fire Marshal (CSFM) Title 19•Meets or exceeds UL Listed standards for audible signal appliances• 15-Watt high-efficiency compression driver •Weather-resistant, vandal-resistant aluminum construction assures protection against water, humidity and corrosion • Reentrant acoustic path•25/70 V transformer featuring a screwdriver adjustable, 7-position watt/impedance selection switch• 5 uF capacitor for line supervision•STH-15S gray-baked epoxy finish; STH-15SR red-baked epoxy finish•Simplified, universal-mounting bracketadjustable in horizontal and vertical planes with banding slots for beam or pillar mounting •Installation terminals and power selector are recessed mounted, and protected by the metalinterface adapter, or clear plastic shieldote:N Please read these specifications and associated installation instructions before using, specifying, or installing this product. Visit /massnotification for current installation instructions.Drawings8.137.90Figure 1. STH-15S front and side viewsSTH-15S (Gray)Eaton is a registered trademark.All other trademarks are property of their respective owners.Eaton1000 Eaton Boulevard Cleveland, OH 44122United States EatonLife safety & mass notification solutions 273 Branchport Ave.Long Branch, NJ 07740/massnotification © 2019 EatonAll Rights Reserved Printed in USAPublication No. TD450078EN February 2019Technical Data TD450078ENEffective February 2019Wheelock STH 15-S Supervised SpeakersArchitects and engineers specificationsThe supervised horn loudspeaker shall be a STH-15S/STH-15SR or approved equal. The horn shall be weather resistant and constructed of heavy-gauge, treated aluminum. The horn shall be able to operate within any ambient temperature environment ranging from 150° F (66° C) to –31° F (–35° C). The horn shall be a double reentrant type with a 15 watt RMS audio power rated compression driver producing a UL rated 101 dB measured at 15 watts at 10 feet. The horn shall have an impedance selection via a 7-position switch of 5554, 2777, 1315, 666, 333, 83 & 42. Power taps shall be available at 0.9, 1.8, 3.8, 7.5 and 15 watts for the 70-volt line; and 0.48, 0.94, 1.8, 7.5 and 15 watts for the 25-volt line. The frequency response range shall be 400–4,000 Hz. The horn shall have a dispersion of 70 degrees. The horn assembly shall be fur-nished with a mounting bracket that allows adjustment on either a vertical or horizontal plane with a single locking pin and include provisions for mounting, banding or strapping. Wiring terminals shall be fully enclosed, and a vandal-resistant adapter cover shall provide connection protection for cable or conduit. The horn shall be 8.7” W x 9.3” H x 9.4” L (22.1 x 23.62 x 23.9 cm). The horn shall be finished in gray- (STH-15S) or red- (STH-15SR) baked epoxy.ote:N Due to continuous development of our products, specifications and offerings are subject to change without notice in accordance with Cooper Wheelock, Inc., dba Eaton, standard terms and conditions.WE ENCOURAGE AND SUPPORT NICET CERTIFICATION3-YEAR WARRANTYT able 1. Specifications and ordering informationModel NumberOrder CodeFinishDescriptionWeightSTH-15S 7937Gray 8.7” Dia. Supervised, Weatherproof, 15 Watt Horn, Loudspeaker with Transformer, Aluminum 4.5 lbs. (2.0 kgs.)STH-15SR 7938Red 8.7” Dia. Supervised, Weatherproof, 15 Watt Horn, Loudspeaker with Transformer, Aluminum 4.5 lbs. (2.0 kgs.)SHMP-R 8154Red UL Listed adapter plate, designed to mount the STH-15SR horn speaker (7938) to a RSSP strobe mounting plate. For surface mounting applications, the SBL2-R (6988) surface-mount backbox is required.—STH-RSSP-KIT6096RedWeatherproof 15 watt supervised 25/70 horn loudspeaker and 15/30/75/110cd strobe with mounting plate, adjustable mounting base for horn and backbox. This kit includes STH-15SR, SHMP-R, RSSP-24MCW-FR, & SBL2-R.—STH-RSSP-KIT-N 5943RedWeatherproof 15 watt supervised 25/70 horn loudspeaker and 15/30/75/110cd strobe with mounting plate, adjustable mounting base for horn and backbox. This kit includes STH-15SR, SHMP-R, RSSP-24MCW-NR, & SBL2-R.T able 2. STH-15S & STH-15SR Power switch selections70.7 Volts 25 Volts SettingImpedence (Ohms)WattsdB @ 10 ft.WattsdB @ 10 ft.15,5540.9W 91Not used Not used 22,777 1.8W 93Not used Not used 31,315 3.8W 960.48W 8746667.5W 980.94W 90533315.0W 101 1.8W 93683Not used Not used 7.5W 98742Not used Not used 15.0W 100。

Product InformationExtract-N-Amp™ Tissue PCR KitXNAT2, XNAT2RProduct DescriptionThe Extract-N-Amp™ Tissue PCR Kit for direct PCR contains the reagents needed to rapidly extract and amplify genomic DNA from mouse tails and other animal tissues, buccal swabs, hair shafts, and saliva. Briefly, the DNA is released from the starting material by incubating the sample with a mixture of the Extraction Solution and the Tissue Preparation Solution at room temperature for 10 minutes. There is no need for mechanical disruption, organic extraction, column purification, or precipitation of the DNA.After adding Neutralization Solution B, the extract is ready for PCR. An aliquot of the neutralized extract is then combined with the Extract-N-Amp™ PCR Reaction Mix and user-provided PCR primers to amplify target DNA. The Extract-N-Amp™ PCR Reaction Mix is a 2X ready mix containing buffer, salts, dNTPs, and Taq polymerase. It is optimized specifically for use with the extraction reagents. It also contains the JumpStart Taq antibody for hot start PCR to enhance specificity but does not contain the inert red dye found in the REDExtract-N-Amp™ PCR Reaction Mix.Reagents Provided Cat. No. XNAT2 100 Preps,100 PCRsXNAT2R 1000 Preps, 1000 PCRsExtraction SolutionE7526 24 mL 240 mL Tissue Preparation Solution T3073 3 mL 30 mL Neutralization Solution BN391024 mL240 mLExtract-N-Amp™ PCR Reaction Mix This is a 2X PCR reaction mix containing buffer, salts, dNTPs, Taq polymerase, and JumpStart™ Taq antibody.E30041.2 mL12 mLReagents and Equipment Required(Not Provided)•Microcentrifuge tubes (1.5 or 2 mL) or multi-well plate for extractions (200 μL minimal well volume) • Small dissecting scissors• Forceps (small to medium in size)• Buccal swab - Sterile foam tipped applicator (Cat. No. WHAWB100032)•Sample collection card - Bloodstain card (Cat. No. WHAWB100014)• Tubes or plate for PCR• Heat block or thermal cycler at 95 °C • PCR Primers (Cat. No. OLIGO) • Thermal cycler•Water, PCR Reagent (Cat. No. W1754)Precautions and DisclaimerThis product is for R&D use only. Not for drug, household, or other uses. Please consult the Safety Data Sheet for information regarding hazards and safe handling practices.StorageThe Extract-N-Amp™ Tissue PCR Kit can be stored at 2 to 8 °C for up to 3 weeks. For long-term storage, greater than 3 weeks, -20 °C is recommended. Do not store in a "frost-free" freezer.ProcedureAll steps are carried out at room temperature unless otherwise noted.DNA Extraction from Mouse Tails, Animal Tissues, Hair, or Saliva1.Pipette 100 μL of Extraction Solution into amicrocentrifuge tube or well of a multi-well plate.Add 25 μL of Tissue Preparation Solution to thetube or well and pipette up and down to mix.Note: If several extractions will be performed,sufficient volumes of Extraction and TissuePreparation Solutions may be pre-mixed in a ratio of 4:1 up to 2 hours before use.2.For fresh or frozen mouse tails: Rinse thescissors and forceps in 70% ethanol prior to useand between different samples. Place a 0.5–1 cm piece of mouse tail tip (cut end down) into thesolution. Mix thoroughly by vortexing or pipetting.Ensure the mouse tail is in solution.Note: For fresh mouse tails, perform extractions within 30 minutes of snipping the tail.For animal tissues: Rinse the scissors or scalpel and forceps in 70% ethanol prior to use andbetween different samples. Place a 2–10 mgpiece of tissue into the solution. Mix thoroughlyby vortexing or pipetting. Ensure the tissue is inthe solution.For hair shafts: Rinse the scissors and forceps in 70% ethanol prior to use and between differentsamples. Trim excess off of the hair shaft leaving the root and place sample (root end down) intosolution. Only one hair shaft, with root, isrequired per extraction.For Saliva: Pipette 10 μL of saliva into thesolution. Mix thoroughly by vortexing or pipetting.For saliva dried on card: Pipette 50 μL of saliva onto collection card and allow the card to dry.Rinse the punch in 70% ethanol prior to use andbetween different samples. Punch a disk(preferably 1/8 inch or 3 mm) out of the cardfrom the area with the dried saliva sample. Place disk into the solution. Tap tube or plate on hardsurface to ensure disk is in solution forincubation period.3.Incubate sample at room temperature for10 minutes.4.Incubate sample at 95 °C for 3 minutes.Note: Tissues will not be completely digested atthe end of the incubations. This is normal and will not affect performance.5.Add 100 μL of Neutralization Solution B to sampleand mix by vortexing.6.Store the neutralized tissue extract at 4 °C oruse immediately in PCR amplification.Note: For long term storage, remove theundigested tissue or transfer the extracts tonew tubes or wells. Extracts may now be storedat 4 °C for at least 6 months without notable loss in most cases.DNA Extraction for Buccal Swabs1.Collect buccal cells on swab and allow theswab to dry. Drying time is approximately10 to 15 minutes.Note: Due to the low volume of solution used for DNA extraction, a foam tipped swab should beused. Swabs with fibrous tips, such as cotton orDacron®, should be avoided because the solution cannot be recovered efficiently.2.Pipette 200 μL of Extraction Solution into amicrocentrifuge tube. Add 25 μL of TissuePreparation Solution to the tube and pipette upand down to mix.Note: If several extractions will be performed,sufficient volumes of Extraction and TissuePreparation Solutions may be pre-mixed ina ratio of 8:1 up to 2 hours before use.3.Place dried buccal swab into solution and incubateat room temperature for 1 minute.4.Twirl swab in solution 10 times and then removeexcess solution from the swab into the tube bytwirling swab firmly against the side of the tube.Discard the swab. Close the tube andvortex briefly.5.Incubate sample at room temperature for10 minutes.6.Incubate sample at 95 °C for 3 minutes.7.Add 200 μL of Neutralization Solution B to sampleand mix by vortexing.8.Store the neutralized extract at 4 °C or useimmediately in PCR. Continue to PCRamplification.Note: Extracts may be stored at 4 °C for at least6 months without notable loss in most cases. PCR AmplificationThe Extract-N-Amp™ PCR Reaction Mix contains JumpStart™ Taq antibody for specific hot start amplification. Therefore, PCR mixtures can be assembled at room temperature without premature Taq DNA polymerase activity.Typical final primer concentrations are approximately 0.4 μM each. The optimal primer concentration and cycling parameters will depend on the system being used.1.Add the following reagents to a thin-walled PCRmicrocentrifuge tube or plate:Reagent VolumeWater, PCR grade VariableExtract-N-Amp™ PCRreaction mix 10 μLForward primer VariableReverse primer VariableTissue extract 4 μL*Total volume 20 μL*The Extract-N-Amp™ PCR Reaction Mix isformulated to compensate for components in the Extraction, Tissue Preparation, and Neutralization Solutions. If less than 4 µL of tissue extract isadded to the PCR reaction volume, use a 50:50mixture of Extraction and Neutralization BSolutions to bring the volume of tissue extract upto 4 μL.2.Mix gently.3.For thermal cyclers without a heated lid, add20 μL of mineral oil on top of the mixture in eachtube to prevent evaporation.4.Perform thermal cycling. The amplificationparameters should be optimized for individualprimers, template, and thermal cycler.Common cycling parameters:Step Temperature Time Cycles InitialDenaturation 94 °C 3 minutes 1 Denaturation 94 °C 30 seconds Annealing 45 to 68 °C 30 seconds 30-35 Extension 72 °C 1-2 minutes(1 min/kb)FinalExtension 72 °C 10 minutes 1 Hold 4 °C Indefinitely5.The amplified DNA can be loaded onto an agarosegel after the PCR is completed with the addition ofa separate loading buffer/tracking dye such as GelLoading Solution, Cat. No. G2526.Note: PCR products can be purified, if desired, fordownstream applications such as sequencing withthe GenElute PCR Clean-Up Kit, Cat. No.NA1020.Troubleshooting GuideProblem Cause SolutionLittle or no PCR product is detected. PCR reaction may beinhibited due tocontaminants in thetissue extract.Dilute the tissue extract with a 50:50 mix of Extractionand Neutralization Solutions. To test for inhibition, includea DNA control and/or spike a known amount of template(100-500 copies) into the PCR along with the tissue extract. Extraction isinsufficient.Incubate samples at 55 °C for 10 minutes instead ofroom temperature.A PCR component maybe missing or degraded.Run a positive control to ensure that componentsare functioning. A checklist is also recommendedwhen assembling reactions.There may be too fewcycles performed. Increase the number of cycles (5-10 additional cycles at a time). The annealingtemperature maybe too high.Decrease the annealing temperature in 2-4 °C increments.The primers may notbe designed optimally.Confirm the accuracy of the sequence information. If theprimers are less than 22 nucleotides long, try to lengthen theprimer to 25-30 nucleotides. If the primer has a GC contentof less than 45%, try to redesign the primer with a GCcontent of 45-60%.The extension timemay be too short.Increase the extension time in 1-minute increments, especiallyfor long templates.Target templateis difficult.In most cases, inherently difficult targets are due to unusuallyhigh GC content and/or secondary structure. Betaine, Cat. No.B0300, has been reported to help amplification of high GCcontent templates at a concentration of 1.0-1.7 M.Multiple products JumpStart™ Taqantibody is notworking correctly.Do not use DMSO or formamide with Extract-N-Amp™ PCRReaction Mix. It can interfere with the enzyme-antibodycomplex. Other cosolvents, solutes (e.g., salts), and extremesin pH or other reaction conditions may reduce the affinity ofthe JumpStart™ Taq antibody for Taq polymerase and therebycompromise its effectiveness.TouchdownPCR maybe needed.“Touchdown” PCR significantly improves the specificity of manyPCR reactions in various applications. Touchdown PCR involvesusing an annealing/extension temperature that is higher thanthe TM of the primers during the initial PCR cycles. Theannealing/extension temperature is then reduced to the primerTM for the remaining PCR cycles. The change can be performedin a single step or in increments over several cycles.Negative control shows a PCR product or “false positive” result. Reagents arecontaminated.Include a reagent blank without DNA template be included asa control in every PCR run to determine if the reagents used inextraction or PCR are contaminated with a template froma previous reaction.Tissue is not digested after incubations. Tissue is not expectedto be completelydigested.The REDExtract-N-Amp™ Tissue PCR Kit does not require thetissue to be completely digested. Sufficient DNA is released forPCR without completely digesting the tissue.Buccal swab absorbed all the solution. The recommended typeof swab was not used.Due to the low volume of solution used for DNA extraction, afoam tipped swab should be used. Swabs with fibrous tips, suchas cotton or Dacron®, should be avoided because the solutioncannot be recovered efficiently.References1.Dieffenbach, C.W., and Dveksler, G.S. (Eds.), PCRPrimer: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, New York (1995).2.Don, R.H. et al., ‘Touchdown' PCR to circumventspurious priming during gene amplification.Nucleic Acids Res., 19, 4008 (1991).3.Erlich, H.A. (Ed.), PCR Technology: Principles andApplications for DNA Amplification, StocktonPress, New York (1989).4.Griffin, H.G., and Griffin, A.M. (Eds.), PCRTechnology: Current Innovations, CRC Press,Boca Raton, FL (1994).5.Innis, M.A., et al., (Eds.), PCR Strategies,Academic Press, New York (1995).6.Innis, M., et al., (Eds.), PCR Protocols: A Guide toMethods and Applications, Academic Press, SanDiego, California (1990).7.McPherson, M.J. et al., (Eds.), PCR 2: A PracticalApproach, IRL Press, New York (1995).8.Newton, C.R. (Ed.), PCR: Essential Data, JohnWiley & Sons, New York (1995).9.Roux, K.H. Optimization and troubleshooting inPCR. PCR Methods Appl., 4, 5185-5194 (1995).10.Saiki, R., PCR Technology: Principles andApplications for DNA Amplification, Stockton, New York (1989). Product OrderingOrder products online at Related Products Cat. No.Ethanol E7148; E7023; 459836 Forceps,micro-dissecting F4267PCR Marker P9577PCR microtubes Z374873; Z374962;Z374881PCR multi-well plates Z374903Precast Agarose Gels P6097Sealing mats & tapes Z374938; A2350TBE Buffer T4415, T6400, T9525The life science business of Merck operatesas MilliporeSigma in the U.S. and Canada.Merck, Extract-N-Amp, REDExtract-N-Amp, JumpStart, GenElute and Sigma-Aldrich are trademarks of Merck KGaA, Darmstadt, Germany or its affiliates. All other trademarks are theproperty of their respective owners. Detailed information on trademarks is available via publicly accessible resources.NoticeWe provide information and advice to our customers on application technologies and regulatory matters to the best of our knowledge and ability, but without obligation or liability. Existing laws and regulations are to be observed in all cases by our customers. This also applies in respect to any rights of third parties. Our information and advice do not relieve our customers of their own responsibility for checking the suitability of our products for the envisaged purpose. The information in this document is subject to change without notice and should not be construed as a commitment by the manufacturing or selling entity, or an affiliate. We assume no responsibility for any errors that may appear in this document. Technical AssistanceVisit the tech service page at/techservice.Terms and Conditions of SaleWarranty, use restrictions, and other conditions of sale may be found at /terms. Contact InformationFor the location of the office nearest you, go to /offices.。

1TUNEL Apoptosis Detection Kit Cat. No. L00297(For Paraffin-embedded Tissue Sections, Biotin labeled POD ) Technical Manual No.0263 Version 01132011I Description ......................................................................... ..................... 1 II Key Features ...................................................................... . .................... 1 III Kit Contents ................................................................ . ........................... 1 IV Storage..................................................................................................... 2 V Protocol ....................................................... ............................................ 2 VI Related Products ........................................................................................ 5 VII Troubleshooting ........................................................................................ 6 VIII Ordering Information .......................................................................... . (7)I. DESCRIPTIONThe TUNEL Apoptosis Detection Kit for Paraffin-embedded Tissue Sections (Biotin labeled POD ) (Cat. No. L00297) is one of GenScrip ’s newly introduced products. The kit can detect fragmented DNA in the nucleus during apoptosis. In this modified TUNEL assay kit, biotinylated nucleotide is labeled at the DNA 3´-OH ends using the natural or recombinant terminal deoxynucleotidyl transferase (TdT or rTdT). Then, horseradish peroxidase-labeled streptavidin (streptavidin-HRP) is bound to these biotinylated nucleotides, which are detected using the peroxidase substrate, hydrogen peroxide, and 3,3’-diaminobenzidine (DAB), a stable chromogen. Using this procedure, apoptotic nuclei are stained dark brown .II. KEY FEATURESSimplified Procedure: The kit contains ready-to-use reagents, including proteinase K, DAB and DNase I Enhanced Sensitivity: This kit can assay the cells during the early stages of apoptosis. Enhanced Specificity: The kit can stain apoptotic cells.Streamlined Process: The entire procedure takes about three hours.Increased Convenience: The results can be observed by light microscope. High Veracity ：The kit contains positive control reagent.III. KIT CONTENTSThe TUNEL Apoptosis Detection Kit (L00297) employs biotinylated nucleotides (Biotin-11-dUTP), horseradish peroxidase-labeled streptavidin, TdT, and DAB.2IV. STORAGEStore streptavidin-HRP at 4°C, and do not expose it to light. Store the rest of the kit at -20°C. It will remain stable for one year.V . TUNEL Apoptosis Detection Kit PROTOCOLBefore use, order or prepare the following:Fixation Solution: 4% paraformaldehyde in PBS, pH 7.4, freshly prepared. Blocking Solution: 3% H 2O 2 in methanol. e.g. 1 ml 30% H 2O 2 + 9ml methanol.Permeabilization Solution: 0.1% Triton X-100 and 0.1% sodium citrate in water, freshly prepared.Note ：1. Please centrifuge the reagents in the kit before use.2. Please prepare the proper amount of TUNEL Reaction Mixture according to the amount of the samples to save reagent.3. The DAB is powder, please dissolve the DAB powder in PBS to make 20×DAB buffer (10 mg/ml DBA buffer) before use.1. Preparing Conventional Paraffin-embedded Tissue Sections3﹡ Alternative TreatmentsThere are other methods of preparing Paraffin-embedded Tissue Sections:1. Incubate the dewaxed and rehydrated tissue sections with Permeabilization solution for 8-10minutes. Permeabilization Solution contains 0.1% TritonX –100 and 0.1% sodium citrate in water, freshly prepared.2. Incubate the dewaxed and rehydrated tissue sections with Pepsin Buffer * or Trypsin Buffer *, for 8-10 minutes.Pepsin Buffer* contains 0.25%-0.5% pepsin in HCl buffer, pH 2.0 Trypsin Buffer * contains 0.25%-0.5% trypsin in 0.01M HCl buffer.3. Incubate the dewaxed and rehydrated tissue sections with 200 ml 0.1 M Citrate Buffer (pH 6.0) in a plastic jar. Irradiate with 350 W microwaves for five minutes.42. Preparing Particular Paraffin-embedded Tissue Sections (e.g. cardiac muscle and brain tissue)Controls:Negative control: Employ the cells or sections as described the labeling protocol. Label solution but do not addany Terminal Deoxynucleotidyl Transferase (TdT) to the TUNEL Reaction Mixture.Positive control: Before beginning the labeling procedures, incubate the fixed and permeabilized cells or sectionswith 100 μl DNase I Solution for 10 minutes at 15-25°C to induce DNA strand degradation.(DNase I Solution contains 30000 U/ml-50000 U/ml DNase I (grade I) depending on the sample to be stained in 1X DNase I buffer. One example of 1X DNase I buffer is 10 mM CaCl 2, 6 mM MgCl 2, and 10 mM NaCl in 40 mM Tris-HCl, pH 7.9)5Labeling Protocol:*20X DAB buffer (10 mg/mL DAB buffer ) contains 10 mg DAB dissolved in1.0 ml PBS buffer.VI. RELATED PRODUCTSTUNEL Universal Apoptosis Detection Kit (Biotin labeled POD), Cat. No. L00290TUNEL Apoptosis Detection Kit for Adherent Cells (Biotin labeled POD), Cat. No. L002966TUNEL Apoptosis Detection Kit for Adherent Cells (FITC labeled POD), Cat. No. L00299TUNEL Apoptosis Detection Kit for Paraffin-embedded Tissue Sections (FITC labeled POD), Cat. No. L00300 TUNEL Apoptosis Detection Kit for Cryopreserved Tissue Sections (FITC labeled POD), Cat. No. L00301VII. TROUBLESHOOTING7TdT Dilution Buffer* contains 150 mM KCl, 1 mM 2-mercaptoethanol, and 50% glycerol in 60 mM KPB, pH7.2VIII. ORDER INFORMATIONTUNEL Apoptosis Detection Kit for Paraffin-embedded Tissue Sections (Biotin labeled POD), Cat. No. L00297GenScript USA Inc. 860 Centennial Ave., Piscataway, NJ 08854 Tel: 1-877-436-7472 Fax: 1-732-210-0262Email:*********************Web: For Research Use Only.。