MIT-SCIENCE-Lectures-fa01lec08 (2)

Lecture Notes - 37.24/7.88J/5.48JThe Protein Folding Problem• Reprise RNase refolding• General Features of Globular proteins• Interior PackingRnase RefoldingWe can cartoon the experiments:Assume that reduced form is unfolded and populates an ensemble of unfolded states in 8M urea:[U]Rapidly exchanging statistical ensemble of random coils[I]???[N]Native fold, $ S-S bonds, 1 out of 105 possible sets of S-S bonds [Aggregated]Non-native (no enzymatic activity), non-native (scrambled) disulfide bonds.At the end of the reaction we have native stateSoluble inactive – misfolded or perhaps small oligomersPrecipitated: Anfinsen showed that these were S-S bonded network = he called “scrambled”Critical question is nature of the intermediates as go from here to there:If there was a sequence in which these bonds formed, and one could figure out the sequence or pathway, it might give you considerable information on the steps in the folding pathway.So certainly we need to understand native-fold, and interactions that determine it, stabilize it once formed;However this does not solve problemWe will return to the question after reviewing the general anatomy of globular proteins, which will occupy most of next week.General features of 3-D structures of solved proteins; Globular, Soluble proteins:A. Isolation and CrystallizationThe first crystals of proteins sufficiently large and ordered to diffract X-rays were prepared of the digestive enzyme pepsin:Bernal, J.D., and Dorothy Crowfoot. Nature (1934): 133, 794.This was followed by crystals of insulin, Lactalbumin, hemoglobin, andchymotrypsin:Bernal, Fankuchen, and Perutz (1938)The rise to power of the Nazis in Germany and Italy and the outbreak ofwar brought all these studies to a halt. Bernal led the world scientificcommunity into opposition to the fascists. This was not only with respect to the their persecution of Jewish scientists, but that the notion of Aryanscience different from the general growth of knowledge, represented abroader attack and the growth and communication of knowledge.The rebuilding and repopulating of the civilian biomedical infrastructuretook about ten years, and re-launched in the 1950’s. In England - BritishMedical Research Council, in US - National Institutes of Health.Solution of Myoglobin structure by John Kendrew in 1958 and hemoglobin structure in 1962 by Max Perutz - it became clear that alpha helix actually present in globular proteins. With the solution of the lysozyme structure by David Phillips (1966), revealed that anti-parallel beta-pleated sheet alsopresent in globular proteins.B. Review Criteria (Biases) for the selection of proteins forcrystallization and perhaps into the success or failure ofcrystallization1. Available in large quantities - usually extracellular protein fromextracellular fluids• Hemoglobin from blood• Myoglobin from muscle• Lysozyme from egg white/ tears??• Ribonuclease from stomach??• Insulin from pancreas??• Lactalbumin from milk ??• Chymotrypsin; from saliva, stomach??2. Stable during purification• Resistant to Residual proteases• Does not aggregate• Resistant to Cold denaturation3. Very soluble in aqueous buffersThis excludes:• Fibrous proteins; evolved to interact with each otherto form structures; keratin, collagen• Other Structural proteins; ribosome structuralproteins, histones, actins, tubulins• Membrane proteins4. Must crystallize• Proteins which behave differently than the dogma;take multiple conformations in solutionProtein database sharply under-represents – fibrous proteins, structural proteins, membrane proteinsC. Structures whose atoms have been located at high resolution- Globular aqueous soluble: 1,100 domains(- Membrane: 12)(- Fibrous: 5)This is the class of proteins for which single crystals have been obtained.Clearly the most extensive database is for proteins soluble in aqueoussolutions and which form crystals.D. General Features of Crystallized Globular Proteins1. Surface/Volume RelationshipsGlobular proteins have relatively sharply defined:• Exterior Surface = H20 Interface• Interior volume - Is the interior of a native proteincrystalline or oily?A quantitative answer to this was given by Richards:"The Interpretation of Protein Structures: Total Volumes, Group Volumes and Packing Density" Frederic M. Richards (1974) J. Mol. Biol., 82, 1 - 14.Problem comes down to calculating how densely packed atoms are inprotein molecules?We can define the packing density of a molecule as:Volume of its van der Waals envelopes of its constituent atoms / actual volume of the intact folded moleculeThis value is dimensionless- Close packed hard spheres = 0.74- Close packed infinitely long cylinders = 0.91- Crystals of various small organic molecules 0.70 - 0.78 values (<0.6very rare)The van der Waals radii - from interatomic distances of nonbondedatoms in organic crystals.However calculation of the volume of irregular structures not trivial.Richards’ procedure made use of a geometrical construct calledVoronoi polyhedra.• Draw vector from each atom to closest surroundingatoms.• Draw a plane through it corresponding to intersectionof van der waals radii. This will define a polygon.• When you do this for all atoms space is completelyfilled.• Thus obtain geometrically legitimate volume. Cancompute this from atomic coordinates.For the following solved proteins, the average packing density:• Hen egg white lysozyme = 0.75• Ribonuclease S = 0.74Conclusion: The interior of globular proteins is as tightly packed as areamino acids in organic crystals.Subsequent investigations have supported this general result for thatset of proteins included in crystallized set.Counter argument; rigidity necessary for crystallization is only found inthose proteins which are continuously dense and lack hinges.2. Are there interior cavities or entrained solvent bobs?Careful examination of a larger set of proteins was carried out byA.A. Rashin, Michael Iofin, and Barry Honig (1986) "Internal Cavities and BuriedWaters in Globular Proteins" Biochemistry, 25, 3619-3625.These procedures involve in general:• Construction of Van der Waals radii;• Find places where these radii not buried or in contact with other radii;• Use a spherical probe (water model = sphere radius 1.4A) walkalong van der Waals radii with smaller and smaller probe to findplaces that can walk alongAccessible surface area is defined by center of water molecule rollingover van der Waals surface. Thus there exists inaccessible surface area.Gives an estimate of volume of cavity and accessible surface area.H2Os# Protein MW#VolA3Pancreatic Trypsin Inhibitor 6,000 2 70 4cytochrome c 11,000 5 34 24115ribonuclease 13,000egg lysozyme 14,000 8 190 54019erythrocruorin 14,0001391Myoglobin 17,0002317494trypsin 23,00013chymotrypsin 26,000 26 571 10• Cavities = less than 2% of the volumes of theseproteins.• No single cavity can host a probe of 2A or more.• Almost all cavities become connected to proteinsurface as probe diameter goes down to 0.4 A.What does this suggest?Suggests that these represent channels or hinges.Volume of internal water molecule for larger cavities is about 30AVan der waals radius of water is about 1.4 ASome cavities which appear non-polar can contain a water moleculeforming three hydrogen bonds. This is because the hydrogen bond canbe longer than the sum of the van der waals radius of a polar atom anda probe., and thus some polar atoms with which water forms hydrogenbonds may not contribute to the accessible surface.Note: those cavities that seem to be empty could be contributing boundwater, but if water crystallographically not fixed, smeared out.3. Functional Significance of small cavitiesLargest empty cavity in their sample located between helices B, E, andG, between two domains of the globin.Conserved in six other myoglobin type proteins (Very diverse). May beimportant for relative motions of helices.More than half of cavities in multi-domain proteins are at domaininterfaces.He considers similar, linkage explanation, rather than packing problem.Prediction; Those sequences that have evolved can close pack?Question: WHAT FRACTION OF amino acid sequences is there noclose packed globular structure?For retinal containing pigments models suggest that cavity of 100Awould allow for rotation of chromophore.Further studies carried out by:"Interior and Surface of Monomeric Proteins" Susan Miller, Joel Janin Arthur Lesk and Cyrus Chothia (1987) J. Mol. Biol., 196, 641-656.For example lysines and arginines almost always at surface (<4%buried)4. Additional Features of Inside OutsideGeneral Features of Globular proteins• No Knots• More than half of the polypeptide sequence isorganized into regular secondary structure,predominantly alpha helices and beta sheets• Interiors are densely packed - Extremely rare to burybulk solvent• Buried charges very rareo In rare cases, ion pair, metal complex, oractive site• Interiors are hydrophobic (carbonyls and amides areH-bonded)• A large fraction of the accessible surface of theextended polypeptide chain is buried in the proteininterior.E. Conclusions re protein folding1) Buried side chains truly removed from water: Major energetic contribution toprotein folding; but driving force, as originally proposed by Walter Kauzmann, is entropic effect on water structure; hydrophobic residues cannot H bondwith water; organizes water molecules with respect to own partners.2) These side chains almost always hydrophobic: extremely rare to burycharged side chains; If the inside of a protein is closely packed and excludes water, becomes quite clear that in fact the inside and the outside are verydifferent environments. Therefore the partitioning of residues into the chainbetween interior and surface positions may be very important in defining fold.3) Contradiction: Burying side chains also requires burying backbone; butbackbone has Carbonyl oxygens and amide nitrogens which are hydrophilic, polar groups;4) But in actual fact, largest number of peptide bonds in proteins are partof regular secondary structures, alpha helices and beta sheets: partialcharges are neutralized by maximal hydorgen bond formation:5) SO naively folding processes may have at least two level of organizationFormation of secondary structure, docking against each other to formtertiary structure; Framework model:Now clearly, given the large fraction of chain that is in regular secondarystructure, a substantial fraction of the internal packing of globular proteins is the...So at least two processes that we need to investigate:• Formation of secondary structure;• Next level; packing of secondary structure into tertiary structure: Might be tightly coupled;F. Packing of Secondary StrcuturesOne of the determinants of the shapes of proteins and the folds is thepacking of the units of secondary structure against each other.Short amino acid sequences = peptides > At room temperature in constantmotion; flickering in and out between a variety of conformations;Homopolymers; In solution also flickering in and out between non-regularconformations and mixture of these with alpha helices;Two levels of Packing:• Within units of secondary structure; alpha helix, beta strands• Between units of secondary structure- helix/helix, helix /sheet• Packing Interactions critical for formation of native structure.。

7.88 Lecture Notes - 97.24/7.88J/5.48JThe Protein Folding Problem• Fluorescence spectroscopy• Denaturation and Denaturing agents• Denatured State as a random coil (First Approx.)• Renaturation/Refolding Protocols• Detection of partially folded IntermediatesSo far we have examined the experimental evidence for three cases• Ribonuclease S• Heptad Repeat protein -Tropomyosin ; Coil <> helix transition in aqueous solution:• S-peptide coil >helix transition in solutionHowever, as we noted earlier the 22,000 + proteins in the protein database are primarily soluble globular proteins; And probably more than half to 3/4 of the proteins encoded by genomes are in this class:So need to understand how sequence drives fold, or to be A probably the majority of proteins encodedMethods for the study of the conformation of folding intermediatesA. Fluorescence SpectroscopyJ. R. Lakowicz Ch 23 pp518-567Many molecules that absorb light in the UV or visible spectra, also re-emit photons, at longer wavelength: FluorescencePhe Tyr and Tryp absorb in the region of:Amino Acid Abs max (nm) Molar absorbance M-1 cm-1197 Phe 257.41420 Tyr 274.65600 Tryp 279.8Absorbance A =log10(I o/I):I o is transmittance by reference solution, I is transmittance by sample.Molar absorbance is = A/bc, where b is path length in centimeters, and c is concentration in moles/liter280mu. Phe peak is about 255 but 1/20 that of tryp peak at 280.Absorption in this region of the spectrum is due to changes in electronic energy levels, levels of orbital electrons.Photon absorption occurs in 10(-15) seconds, so short that nucleus doesn't change much in time interval; so goes up in energy level almost instantaneously , but lifetime is much longer, 10(-8) seconds.Return to ground state usually multi-step:• small losses of energy in atomic collisions >> Goes back to lowest vibrational energy level state of excited electronic state (faster than emission);If molecule doesn't blow up, then after short period of time,• returns to lowest energy level emitting a photon; since excited state has lost a little energy, then photon emitted will be lower energy, longer wavelength thanphoton absorbed;Lambda max for fluorescence:2820.04Phe0.21303Tyr0.20Tryp340Emission occurs on nanosecond time scale; Process occurs like radioactive decay I = I o e (-t/g), where t is time after end of light, g is average lifetime of fluorescent state; Because emission is a property of valence electrons, sensitive to environment;Fluorescence; tryptophane: in water 350; buried in proteins 330.Native florescent spectrumDenatured fluorescent spectrum:B. Denaturation and the Denatured StateThese studies were carried on purified chains refolding in vitro; of course in cell s chainsreleased from ribosomes, but some 20 years passed before it was possible to studyprotein folding intermediates in vivo:Now let’s consider studying this problem for a complete polypeptide chain of a globularprotein in the general case, for example globin with its 7 helices; to examine the foldingpathway for the globin chain in the test tube, we would need unfolded molecules;We also need to reach the unfolded or partially unfolded state to recover active forms of incorrectly or misfolded molecules; Eli Lilly manufactures human insulin by expressingthe cloned gene in E. coli. When they harvest the cells the insulin chains accumulate asan insoluble mass called an “inclusion body”. In order to obtain biologically activeinsulin the chains must be solubilized and then refolded in vitro.It turns out that maintaining an unfolded state of biologically evolved polypeptide chains is not trivial In order to investigate how chains reach their native state, need access to some definedunfolded –denatured state.In order to recover correctly folded forms of incorrectly folded or misfolded proteins, alsoneed denatured statePractical;To maintain proteins active, need to understand processes of denaturation.To recover proteins from denatured states, need some knowledge thereof. IN factgeneral result of cloning gene into expression vector, is generation of non nativeaggregated state called an inclusion body:Obtaining native protein requires successfully refolding in vitro;• Requires access to soluble state• Method to study basis of stability of native conformation.• To study folding pathway, need defined unfolded starting state.Denaturation; Process of the loss of nature structure: associated with unusual phasetransition associated with structure loss: upon mild treatment:The denatured state is usually identified by the• Loss of biological functionso Loss of catalytic activityo Loss of ligand binding propertieso Loss of antibody recognition: and• Change in solution propertieso Increased viscosityo Aggregates large enough to scatter lighto Change in spectroscopic properties.Under conditions in which Covalent modification not detectable - The term denatured refers to an operation: it’s the description of a state in terms of having passed through operation.Denaturing Agents:Globular proteins can be denatured with a wide variety of agents:• Heato Denatured chains usually partially structured and aggregated (treatment with additional denaturing agents causes further changes).o Often not reversible on cooling outside very narrow set of conditions.o Covalent side reactions as temperature increases.Tropomyosin is an exception!• pHo Ionization of side chains breaking ion pairs, salt bridgeso Denatured chains highly charged:o Increased charge density leads generalized electrostatic repulsion;o Unfolded chain is structured• Organic solventso Benzeneo Phenolo Trichloroethyleneo Acetoneo Ethanolo Chloroformo Acetonitrile- Often neither native nor denatured state soluble in these solvents- Difficult to compare conformations between immiscible solvents- Some induce alpha-helicity, like TFE• Detergentso sodium dodecyl sulfate- Enormously important for analysis; denatured state binds1.4gm/gram of detergent - denatured state is highly structured:- Often is micellar form that is strongly denaturing; so detergent must be above cmc, critical micelle concentration;- Difficult to remove detergents rapidly and efficientlyo Lithium bromideo Sodium bromideo potassium thiocynate (KSCN)- However, not general ionic strength, NaCl, KCl don't do it.- Ammonium sulfate is stabilizing• High Pressureo Useful for multimeric proteins; dissociation reaction• Organic soluteso UreaNH2 - C=0 - NH2- Not an electrolyte: effects sensitive to pH and ionic strengtho Guanidinium HydrochlorideNH2 - C = (NH2+Cl-) - NH2- Strong electrolyte. So denaturation always coupled with high ionicstrengthExperimental work on protein unfolding as a pre-condition for establishing an unfolding refolding equilibrium is dominated by two reagents;C. What is the State of these Denatured Molecules?In both of these solvents -urea and GuHCL - a wide variety of proteins are denatured to species that approximate very closely to random coils. For example, for a true random coil, whose end to end to distance or radius of gyration is described by:Sensitive measure of molecular volume is viscosity; unfolded chains occupy largervolume than folded, and so interfere with fluid flow, increasing viscosity; Viscosity is a measure of work done to produce a given rate of liquid flow; represents resistance toliquid flow;Add solute, viscosity generally increases.When protein denatures, interaction –binding- surface with solvent increases sharply, >> viscosity increases;Intrinsic viscosities of native and GuHCl (5.0 -7.5M) denatured reduced chains(b-MeTh) –25Certain inorganic salts•Protein MW Native Denatured/Reduced RNase 13,700 3.3 16.6 9.4Lysozyme 14,300 2.7 17.1 6.5Hemoglobin 64,500 3.6 18.9beta lactoglobulin 36,800 3.4 22.8 19.8tropomysosin 76,000 45 33For a truly random coil, intrinsic viscosity is directly related to molecular weight throughan equation of the general form[Have to extrapolate to zero shear to make sure molecules aren't orienting in solution.]etaMo = An bWhere Mo is the mean molecular weight of the amino acid residues;n = number of residuesFinding of a straight line relating log of etaMo to log of Anb Determination of viscosityversus molecular weight after denaturation is good evidence for a random coilconformation in the resulting chainsC. Tanford, K. Kawaharas, and S. Laopanje (1967)Proteins as Radnom Coils. I. Intrinsic viscosities and sedimentation coefficients in concentrated guanidine hydrochloride JACS 89 729.For GuHCl Tanford found A = 77.3, b =0.666If plot logarithmically log {viscosity] M versus logn [n] get linear relationshipHere is data from Charles Tanford on the linear variation of intrinsic viscosity as afunction of chain length for polypeptide chains in high concentrations (5 - 7.5 M GuHCl)at 25°C.log[eta]M olog nA similar result is obtained with the same proteins in 8M urea, with very smalldifferences in parameters, A =76, b =0.655.One care need to take with urea, at neutral and alkaline pH decomposes slowly to form cyanate ion. This reacts with free amino groups to form carbamyl derivatives.D. An Equilibrium Denaturation ExperimentNative protein in buffer: dilute to increasing concentrations of urea: examine properties; for example enzyme activity and fluorescence quenching of tryptophanesIncubate until no further changes:Cautions: urea decomposes to reactive cyanates; watch out for metals contamination: need to re-crystallize ultra-pure stuff;In folded state, prolyl peptide bonds stabilized by folded structure; in unfolded state, isomerization proceeds in solution; very slow; at equilibrium cis trans prolyl peptide bonds different than in first few minutes after unfolding:The general nature of the denaturation process, somewhat independent of method is that it is usually highly cooperative, showing a steep change in the state with the variable. Looks like sloppy phase transition;That is, the molecules are either native or denatured, with limited evidence of intermediates. Thus in the transition state have mixture of native and denatured. Like phase change.The Mechanism of Urea and Guanidinium Denaturation:Large literature on action of GdHCl on proteins, but still no mechanism. This is flip side of the very limited ability to assess what is holding the protein together - high concentrations necessary Organic solutes -Strong electrolyte. So denaturation always coupled with high ionic strength for denaturation, for example 6M, these reagents are occupying roughly half the solvent volume. General notion is that they are acting changing the structure of water.Two studies that give some notion of what is going on:Hibbard and Tulinsky Biochemistry 17, 5460-5468. Equilibrated crystal of alpha-chymotrypsin with 2MGuHCl or with 3M urea and examined diffraction pattern. Obviously this is below denaturation transition, but approaching it.GDHCl disrupted primarily surface of molecules in crystal. Solvent becomes better solvent for surface chains.Urea appeared to diffuse into molecule; perhaps solvates non-polar groups otherwise buried. non-polar M.What about proteins lacking disulfide bonds:E. Criteria for existence of partially folded intermediatesDuring equilibrium unfolding and refolding experiments:Protein diluted into various concentrations of denaturant: incubated until no change in signal; (determine empirically)Renaturation: Fully denatured protein diluted back to increasing concentrations of buffer; samples it until no further change in signal;In reading for Thursday you will see that time this sample has incubated in denaturant isa critical variable in refolding kinetics”1. Complex Equilibrium denaturationHere is equilibrium denaturation/renaturation experiment:If curve has a break in slope, normally interpreted as due to presence of apartially folded intermediate at intermediate denaturant concentrations: This isdata forIn the middle of the transition at last three species populated to some extent, U, I, and N2. Non coincidence of signalsHere is denaturation curve for a protein, in which experimenters following twodifferent signals: fluorescence and circular dichroism;Fluorescence groups being exposed to solvent at lower GdHCl concentration that overall backbone unfolding:Suggests that partially folded species formed, with region around tryp disordered, but most of protein intact:3. Occasionally see third class of curvesHere is one for RNase T from Pace et al RNase T: fluorescence increases, then decreases; Can have other kinds of curvesNow of the utmost importance to distinguish kinetic experiments - initiate reaction follow course, under conditions that back reaction not significant, and equilibrium experiment, in which ignore pathway, examine only distribution of end states:In a kinetic experiment evidence for more than two states would come frompresence of more than one kinetic phase:• If only one transition, U >>N, then expect single rate process:• If in studying kinetics observe complex kinetics, for example:- Initial fast rate followed by slow rate followed by much slower rate, evidence that more than one process going on, must be at leastone other species present;Let’s review point about intermediates:If only two states, then fluorescence either 2 (native) or 1 (quenched) (tryp 59)Lets say monitor some other signal, CD alpha helicity: value is 2 or 5; Then both curves will of necessity have same shape; all values simply sum of two populations:If partially folded intermediate, its properties could differ from N and U: Its tryp could be buried, as in N (f=2), but its helices only partially formed - say CD value three:Then CD curve would differ from fluorescence curve:Then as proceed through folding transition, these values follow distribution of partitioning;Part C。

14.12Game Theory–Midterm IInstructions.This is an open book exam;you can use any written material.You have one hour and 20minutes.Each question is33points.Good luck!1.Consider the following game.1\2L M RT3,24,01,1M2,03,30,0B1,10,22,3a.Iteratively eliminate all the strictly dominated strategies.b.State the rationality/knowledge assumptions corresponding to each elimination.c.What are the rationalizable strategies?d.Find all the Nash equilibria.(Don’t forget the mixed-strategy equilibrium!)2.Consider the following extensive form game.Xa.Find the normal form representation of this game.b.Find all pure strategy Nash equilibria.c.Which of these equilibria are subgame perfect?3.Consider two agents£1,2¤owning one dollar which they can use only after they divide it.Eachplayer’s utility of getting x dollar at t is-t x for- 0,1 .Given any n 0,consider thefollowing n-period symmetric,random bargaining model.Given any date t £0,1,T,n"1¤, we toss a fair coin;if it comes Head(which comes with probability1/2),we select player1;if it comes Tail,we select player2.The selected player makes an offer x,y ¡0,1¢2such that x y t1.Knowing what has been offered,the other player accepts or rejects the offer.If the offer x,y is accepted,the game ends,yielding payoff vector -t x,-t y .If the offer is rejected, we proceed to the next date,when the same procedure is repeated,except for t n"1,after which the game ends,yielding(0,0).The coin tosses at different dates are stochasticallyindependent.And everything described up to here is common knowledge.pute the subgame perfect equilibrium for n 1.What is the value of playing this gamefor a player?(That is,compute the expected utility of each player before the coin-toss,given that they will play the subgame-perfect equilibrium.)pute the subgame perfect equilibrium for n pute the expected utility of eachplayer before the first coin-toss,given that they will play the subgame-perfect equilibrium.c.What is the subgame perfect equilibrium for n u3.。

24.00: Problems of PhilosophyProf. Sally HaslangerOctober 3, 2001RacismsI. Racist PropositionsAppiah distinguishes three importantly different ideas relevant to race and racism:Racialism:...there are heritable characteristics, possessed by members of our species, that allow us to divide them into a small set of races, in such a way that all the members of these races share certain traits and tendencies with each other that they do not share with members of any other race. These traits and tendencies characteristic of a raceconstitute, on the racialist view, a sort of racial essence; and it is part of the content of racialism that the essential heritable characteristics...account for more than the visible morphological characteristics­skin color, hair type,facial features­on the basis of which we make our informal classifications. (5)In other words: A racialist is one who maintains that people who appear similar on the basis of certain inherited physical characteristics (such as skin color, hair type, facial features) share a distinctive "racial essence" that is responsible for a range of psychological and behavioral traits and tendencies.ï Appiah argues (elsewhere) that racialism is false: There is no "racial essence" (genetic or otherwise) underlying the morphological features shared by members of what we count as races that is responsible for (supposed) similarities in traits and tendencies among members of racial groups. In other words, even if there are what we might call superficial races,i.e., groups of people who share certain inherited visible features, there are no racial kinds, i.e., groups unified by sharing a racial essence.ï A consequence of Appiah's denial of racialism is that if there are any psychological/behavioral similarities ("common traits and tendencies") among members of "superficial races", this is due either to historical/cultural/social causes, or it is due to contingent natural correlations, e.g., it might be that the members of genetically isolated groups are similar in many ways, both visibly and psychologically, but in such cases one cannot assume that there is an underlying "nature" or "essence" that explains all the similarities. The correlation of visible and psychological features may be accidental, or due to contextual features, and may break down immediately when the group disperses or when the group's genetic isolation ends.ï Appiah maintains that racialists are wrong in the sense that the hold a false or incorrect view, but because racialism makes no moral or evaluative claims (it doesn't say anything about what's good or bad, what we ought to do or not do), there is nothing wrong morally speaking in being a racialist. As he puts it, racialism "seems to be a cognitive rather than a moral problem." (5)Extrinsic racism:...extrinsic racists make moral distinctions between members of different races because they believe that the racial essence entails certain morally relevant qualities. The basis for the extrinsic racists' discrimination between people is their belief that members of different races differ in respects that warrant the differential treatment,respects­such as honesty or courage or intelligence­that are uncontroversially held...to be acceptable as a basis fortreating people differently. (5)In other words: An extrinsic racist maintains that people of racial group X tend to have the property P, and P is a morally objectionable property (such as dishonesty, laziness, irrationality, etc.) So we are warranted in treating people of racial group X differently (i.e., worse) than others (for at least some apparent racial group X).Intrinsic racism:intrinsic racists..are people who differentiate morally between members of different races because they believe that each race has a different moral status, quite independent of the moral characteristics entailed by its racialessence....an intrinsic racist holds that the bare fact of being the same race is a reason for preferring one person to another. (5-6)In other words: An intrinsic racists maintains that people of racial group X are inherently morally inferior (for at least some apparent racial group X).ï Appiah points out, however, that it would be "odd" to call someone a "racist" if they just happened to be ignorant of all the facts. E.g., someone brought up in a remote location might have only false information about X's and so come to hold what look like racist beliefs; but if in the face of new (and better) evidence she easily corrects her beliefs, then even if she holds some racist beliefs, there is a sense in which she is not a racist.ï So, he suggests, racism is not just a matter of what you believe, but how you believe it: does your belief rest on the evidence you have available to you (or could easily get), or are you unable or unwilling to take advantage of the available evidence? Those who exhibit a pattern in their inadequate attention to the evidence have a "cognitive incapacity"­on Appiah's view this is a form of irrationality--and this "cognitive incapacity" is the source of their racism. They exhibit "distortions of judgement" (8) possibly due to self-interest, self-deception, internalized racist stereotypes, etc.II. Racial PrejudiceGiven these observations, Appiah defines "racial prejudice" as follows:Racial prejudice consists in "the deformation of rationality in judgment [viz., their systematic "incapacity" to collect and assess evidence responsibly] that characterizes those whose racism is more than a theoretical attachment to certain propositions about race." (8) On this view, racial prejudice is a kind of cognitive flaw. For those who are ignorant and hold racist propositions because they have not been exposed to all the evidence, there is hope that more information will lead them to see the error in their views. But those who suffer from racial prejudice need more than information; they need to learn skills of critical reflection that enable them to see through the distortions of ideology and self-interest. (9-10)III. Racism and MoralityAppiah suggests that racism is symptomatic of a kind of irrationality. In the case of extrinsic racists, it consists in a failure to be responsive to evidence concerning the (supposedly inferior) racial group in question, e.g., to evidence whether they really have the questionable property P, and to reasoning concerning the link between generalizations about the group and moral judgements.In the case of intrinsic racists, however, the racism does not lie in the incorrect attribution of certain observable properties to members of a group (it is not like miscalculating whether Whites can jump, or whether Blacks "have rhythm"); the attribution in question concerns moral worth. The intrinsic racist asserts that some groups have greater moral worth than others (or that some individuals, because of their race alone, are more worthy of my regard or loyalty, etc.). Is the intrinsicracist's failing, if it is a failing, a cognitive error? Is it a failure of rationality? Or is it, as Appiah sometimes suggests, (also?) a kind of moral failure?Appiah suggests that the intrinsic racist exhibits a kind of distorted rationality insofar as he under the influence of an ideology that serves the dominant group (8) and uses the racist beliefs "as a basis for inflicting harm" (10). Sometimes intrinsic racism is not used as a basis for harm and is not connected to the power of the dominant group, in which case it is not clearly racism, and not clearly irrational. For example, racially subordinate groups sometimes build solidarity with each other­Appiah mentions Zionists and Black Nationalists­by maintaining that race, in and of itself, is morally significant. Although one might argue that at least some members of these groups use race as a basis for inflicting harm, the relevant question is whether it is ever permissible to hold views that are intrinsically racist. Appiah suggests that it is. Do you agree? Are intrinsic racist beliefs less problematic for some groups than others?But the "distorted rationality" Appiah is trying to point out in the case of intrinsic racists is nothing like a failure to appreciate evidence. Ultimately Appiah's argument is that intrinsic racists misunderstand the nature of public morality. It may be that we are allowed to form special attachments to others, attachments that are based on arbitrary likes and dislikes, in the private domain, e.g., of family. But these special attachments are not allowed to influence us in contexts where morality is at stake. It may be OK to give a birthday gift to your mother and not your professor; but it is not OK to keep your promise to your mother and not to your professor. You must keep all your promises. What the intrinsic racist fails to understand is that from the moral point of view, race is not a legitimate basis for making distinctions between individuals. So the intrinsic racist, on Appiah's view, doesn't simply exhibit a cognitive failure, but also a moral failure.Questions:ï On what basis does Appiah claim that race is not morally relevant? He suggests that it to deny this is to go "against the mainstream of the history of Western moral philosophy" (14). But does he have an argument for it? Does he have evidence for it? How could one go about arguing that race is not morally relevant?ï Could an intrinsic racist charge that Appiah's reliance on the idea that race is morally irrelevant is itself a bit of ideology, i.e., that it is the articulation of a particular "practical consciousness" found in the West? Does saying this show that the idea is false or distorted or problematic?IV. Return to PragmatismIs Pragmatism a good guide to what is epistemically justified? Is it a good guide to what is practically justified? Consider first epistemic justification, using this instance of the Pragmatist principle:Faced with a genuine choice about whether or not to believe extrinsic racism, where there is no compellingevidence in favor of either extrinsic racism or not, we are "free" to decide whether or not to believe extrinsicracism.When is there "no compelling evidence" to settle the matter?(a) when I lack compelling evidence?(b) when no one has found compelling evidence (so far)?(c) when there is, in principle, no compelling evidence?If (a) or (b), then it would seem that the lack of compelling evidence may be due to systematic distortion (my irrationality, or the ideological influences in society that prevent evidence from being properly collected and evaluated). But if systematic distortion is a plausible hypothesis, shouldn't we say that we should withhold belief, and that belief either way is not rationally permissible? However, if we strengthen the Pragmatist principle to require that we withhold belief until all possible evidence is collected (so going for (c)), then we would miss out on many of the advantages James mentions (e.g.,in love) and it isn't clear how far Pragmatism offers an improvement over Evidentialism. Thus it seems that Pragmatism is not a good guide to what's rationally permissible, understood as a matter of epistemic rationality, i.e., how we should proceed in our search for knowledge.Consider pragmatic justification using a different instance of the principle:Faced with a genuine choice (at time t) about whether or not to believe intrinsic racism, where there is nocompelling evidence (at t) in favor of either intrinsic racism or not, we are "free" to decide whether or not tobelieve intrinsic racism.According to Appiah, intrinsic racism is not refutable by (scientific) evidence (8). On his view, however, it is a distorted ideology that can be used to support injustice. If it is sometimes a genuine choice whether to accept intrinsic racism, and if there is no compelling evidence one way or the other­even in principle­then it would seem that according to Pragmatism it is rationally permissible to accept intrinsic racism. But to continue with Appiah, one who endorses this sort of intrinsic racism can be charged with a deep moral failing. Appiah suggests this is not a "cognitive incapacity", but a "moral error"(12). If the intrinsic racist holds the racist beliefs "unthinkingly" then it is unclear that we have a case of autonomous rational behavior at all (see Appiah, 9). Alternatively, if the intrinsic racist is autonomous in this choice of belief (and harmful action based on it), then we should say that Pragmatism allows that morally reprehensible beliefs (and the actions they justify?) are rationally permitted. Is this enough to show that Pragmatism is not a good guide to what's rationally permissible, understood as a matter of practical rationality, i.e., of how we should proceed in our efforts to act rationally?Question: Is there some way to understand or modify Pragmatism to avoid these conclusions?Summary: The phenomena of wishful thinking, ideological distortion, irrational adherence to unfounded beliefs, all call into question our ability to determine if and when we have come to a point when we can be confident there is no evidence to settle the matter and that we're permitted to just choose what to believe. Even if we do reach such a point, we must be aware that our choice of what to believe may have problematic moral consequences. So Pragmatism is not without problems. All things considered is Evidentialism the better choice? Are there further alternatives to these two approaches?。

21L007 After ColumbusTopics for the first essay1. Montaigne’s essay, although it claims otherwise, is based on writtensources, of which Léry’s text is an important one. Pick a topic in Montaigne’s account of the Tupi – making war, religion, ethics, food customs, gender roles – and identify as many differences as you can between the essay and the first-hand account in Léry. Concentrating on those differences which seem to you most significant, lay out for your reader their net effects -- what is the total effect of these differences in each text? In your conclusion, you mightspeculate on why or to what end Montaigne might have altered his account in these ways; or you might consider how Léry evaluates/responds to theinformation Montaigne alters or excludes.2. Léry stands out for his relative open-mindedness, and his willingness (atleast in some areas) to meet the Tupi on equal terms. At the same time, hecondemns other Frenchmen who “forget themselves” so far as to participate fully in Tupi culture, to abandon their different status as Frenchmen. Pick a few places in the text which seem important or interesting in this light, trace how and where, Léry moves along the axes of judgement (does he praise,condemn, or simply report?), differentiation (does he see the Tupi as alien or similar to himself and his kind?), and participation (does he enter the culture or stand outside it?). In your conclusion, you might pick one moment ofLéry’s response as either especially representative, or especially important to you as a reader – then argue for the first, or explain the second.3. According to Paul Lejeune, the Montagnais avoid anger above all;according to Jean de Brébeuf, the Hurons also avoid showing anger orvengeance (JR, 33 51). These observations seem to contrast with Léry andMontaigne’s emphasis on the centrality of vengeance and inveterate hatred in Tupi culture (Léry, 112). What can be learned by examining this apparentpoint of difference? This examination might proceed in several stages,considering the observation, the culture is being observed, and those who aredoing the observing. To begin with, fine-tune the observation (these avoidanger, these rely on it): how do the Tupi encourage or reward anger, forinstance? How do the Hurons discourage it? Then, as you look more broadly at the culture is being observed, consider how much the hypothesis fits andhow much you might want to qualify it: Is anger encouraged in all areas of Tupi life or only some? If the Hurons don't believe in vengeance, whatmotivates them to go to war? Are these cultures really different, and howmuch? Finally, you might ask yourself about the values of the observer and how these might affect their representation of the topic under discussion: do the Jesuits appear to value things that Lery does not care about, for instance, and vice versa? You may take on this topic (anger and vengeance) as it is, or use it as a template for thinking about some other observation or hypothesis. Length: 5 pages, double-spaced (ca. 1500 words).Due date (essay): Monday, Sept. 29Due date (revision): 10/15How to format your paper:Typed/printed, double-spaced, 1” margins. Paragraphs indented 5 spaces at left; do not separate paragraphs by extra blank lines. Quotations of 10 words or less should be integrated into the text; longer quotations should be indented 5 spaces at left and right margins, single spaced, and set off from the text of the essay by a blank line before and after the quotation. (Please see examples below).How to title your paper:Your essay should have a fairly specific title – one which will suggest what you’ve concluded about the differences between Montaigne and Lery, for instance --e.g., “Saintly Savages and Subhuman Cannibals” or “Truth-telling versus Total Fabrication”. (Note: unlike these two, your titles will probably be more subtle and represent viable arguments). “Jean de Léry’s Voyage to Brazil” would not be a good title. It’s worth taking a little thought over the title, not only because it creates the first impression of your essay (that, too); coming up with a phrase which encapsulates your argument can help in focusing that argument.How to quote:Short Quotation (2 kinds)1/ When Montaigne claims that his servant “had lived ten or twelve years in that other world” (115), he is referring to ....[NOTE: when the quotation is integrated into your own sentence, as here -- your words “his servant” are the subject of Montaigne’s verb “had lived” -- make sure the grammar works. To check whether it does, remove the quotation marks and see if the sentence looks right.]2/ Montaigne writes: “skill is a dead and physical possession” (115).Long QuotationHere I am, writing along in my essay, along and along and along. Here comes a quotation, beginning now.They get up with the sun, and immediately after rising they eat for the whole day, forthey have no other meal (111).Okay, quotation’s over. Back to the essay now, with double-spacing and regular margins again. One other thing: anytime you include a long chunk of text, be sure to talk about its details and what, specifically, we should understand from reading it. If there is not enough to say, the quotation should probably be shorter.。

Department of Urban Studies and Planning11.203 – MicroeconomicsFall, 2003Problem Set # 2Answers Due in your TA’s Box on Lecture 6This week’s problems continue applications of supply and demand and elasticity and begin discussion of utility maximization.1. In the U.S., the minimum wage is currently $5.15 per hour. Suppose that 13 millionworkers are paid at this level and the wage elasticity of labor demand for their services is -.4.a) Suppose the government passes legislation raising the minimum wage to $5.50per hour. Carefully explain what will happen to the total number of persons employed and the total amount of money going to minimum wage workers.Illustrate your answer with a diagram.b) As we said in class, an unemployed person is someone who wants to work atthe going market wage, but who cannot find work. Using this definition, calculate the increase in unemployed persons caused by the minimum wage rise. If you need more information to answer the question, carefully explain what additional information you need. Illustrate your answer with diagrams.c) You are part of a community organization in San Antonio, Texas organizing aliving wage campaign in which you use negotiation, political pressure and publicity to get employers to raise the base wage they pay. There are two candidates for the first firm you contact – a large hotel or an equally large firm doing light assembly of electronics components. Using the concept of elasticity, describe which one you choose.2. As we saw in lecture 4, we can begin to examine the incidence of a unit tax – say,$.25 per apple - by drawing two, parallel demand curves. At every quantity, the two demand curves are separated by a vertical distance of $.25 – the amount of the tax.The higher demand curve is the standard demand curve that consumers see (since their payment includes the tax). The lower demand curve is the curve producers now see and respond to – it represents the price the consumer pays minus the $.25 that goes to the tax. Satisfy yourself that the new equilibrium meets the following conditions:-The equilibrium quantity produced occurs at the point where the lower demand curve intersects with the supply curve (i.e. producers areresponding to the tax-reduced price they receive).-Consumers purchase this same equilibrium produced but the price they pay comes from the higher demand curve – i.e. they pay $.25 more perapple (the tax) than producers receive.-The price paid by consumers will increase by some amount – call it X.The price received by producers will fall by –Y (Y is a positivenumber and the price falls by minus that amount). The sum of X + Y= $ .25. The incidence of the tax refers to the way in which the $.25 issplit between the increase to consumers and the fall to producers.a) Draw two examples of the $.25 cent tax being imposed. In the first case, draw thedemand curve very elastic and the supply curve very inelastic. Describe how the tax is being divided between consumer and producer. In the second case, make draw the demand curve very inelastic and the supply curve very elastic. In this case, how is the tax divided between consumer and producer?b) Write in words a rough rule that describes the relationship between demandelasticity, supply elasticity and the incidence of a tax.3) Nicholson, p137, problem 4.7. (To do this problem, you need to understand the concepts of income elasticity and cross-price elasticity of demand. Both of these are discussed in Chapter 4.)4) Anti-AIDs drugs must typically be administered on a rigorous schedule. Failure to observe the schedule will make the drugs ineffective. This means that a country trying to deal with AIDS must carefully consider how to allocate its health budget between money spent on the drugs themselves and money spent on public health infrastructure (e.g. nurses who visit patients to see that drugs are taken on schedule).Define the goal as stabilized AIDs cases and assume the following principles apply: - A government must spend funds on both drugs and nurses to stabilize AIDS cases. Spending money on either alone will produce no results.-If we hold spending on drugs at a constant level, additional spending on nurses will stabilize more cases but each additional nurse will havea smaller impact than the previous nurse. Spending on drugs, holdingspending on nurses constant, shows a similar pattern.Below are four mathematical functions that describe the relationship between drugs, nurses and the number of stabilized cases. Use first derivatives, common sense, and graphs, if appropriate to explain why each function does or does not represent the problem as stated above. (The relevant first derivative formulae are contained in the calculus notes on the web page.)i) # Stabilized Cases = 10*(doses of drugs)2 + 5*(hours of nurses)2ii) # Stabilized Cases = 10*(doses of drugs) + 5*(hours of nurses)iii) # Stabilized Cases = 10*(doses of drugs)1/2 + 5*(hours of nurses)1/2 iv) # Stabilized Cases = 50*((doses of drugs)1/2 )* ((hours of nurses)1/2) where * = the multiplication sign and the exponent ½ = a square root*************************************************************。

M odes of A ssertionKai von FintelMassachusetts Institute of T echnology·Spring20031.I ntroduction1.1A Simple Picture(1)The Red Sox won the pennant.(2)(1)is true in world w iff(=if and only if)the Red Sox won the pennantin w.(3) (1) ={w:the Red Sox won the pennant in w}(4)(1)is true in world w iffw∈ (1) .(5)Beck believes that the Red Sox won the pennant.(6)(5)is true in world w iffBeck believes in w that the Red Sox won thepennant.(7)(5)is true in world w iffevery world w compatible with what Beckbelieves in w is a world in which the Red Sox won the pennant. (8)(5)is true in world w iffevery world w compatible with what Beckbelieves in w is such that w ∈ (1) .(9) (5) ={w:every world w compatible with what Beck believes in w issuch that w ∈ (1) }.(10)Menander doubts that Beck believes that the Red Sox won the pennant.(11)A speaker who asserts a sentenceφproposes that the participants in theconversation all add φ to the common ground.1Modes of Assertion ::24.910::MIT Spring 2003Kai von Fintel(12)The common ground is a body of common assumptions that is meantto approximate "the truth".One hopes that the actual world is one of the worlds compatible with the common ground.1.2Modulation (13)The Red Sox won the pennant,I ⎧⎪⎪⎨⎪⎪⎩hear am sorry to say believe admit ⎫⎪⎪⎬⎪⎪⎭.(14)The Red Sox,(*as) I Mary believe(s),won the pennant.(15)The Red Sox ⎧⎪⎪⎨⎪⎪⎩apparently unfortunately definitely admittedly ⎫⎪⎪⎬⎪⎪⎭won the pennant.(16)The Red Sox won the pennant,which I had (not)expected Mary was glad to hear .(17)The Red Sox must mayhave won the pennant.(18)Here is a wild guess:the Red Sox won the pennant.(19)The damn Red Sox won the pennant.(20)The Red Sox “won”the pennant.(21)U rmson on “P arenthetical V erbs ”[W]hen these versb are used in the first person of the present tense,as is very clear when they occur grammatically in parenthesis,the assertion proper is contained in the indicative clause with which they are associ-ated,which is implied to be both true and reasonable.They themselves have not,in such a use,any descriptive sense but rather function as signals guiding the hearer to a proper appreciation of the statement in its context,social,logical,or evidential.They are not part of the state-ment made,nor additional statements,but function with regard to a statement made rather as ‘R ead with C are ’functions in relation to a subjoined notice,or as the foot stamping and saluting can function in the Army to make clear that one is making an o fficial report.PerhapsLecture Notes ::Part 1::Version 1.1::February 9,2003::21:32:372Modes of Assertion ::24.910::MIT Spring 2003Kai von Fintelthey can be compared to such stage-directions as ‘said in a mournful (confident)tone’with reference to the lines of the play.They help the understanding and assessment of what is said rather than being part of what is said.1.3Embedding(22) a.It is obvious that Parker made a big mistake.b.Parker, it is obvious obviously ,made a big mistake.(23)We have to fire him because he obviously made a big mistake.(24)We have to fire him because it is obvious that he made a big mistake.(25)If it is obvious that he made a big mistake,he will have to be fired.(26)If he obviously made a big mistake,he will have to be fired.(27)If the Red Sox,*(as) I Mary believe(s),won the pennant,I’ll order world series tickets.Suspicion:we need to distinguish parentheticals (side information,as in as I believe )from assertion modulators (as in I believe ).as I believe =which is what I believe –by the wayPerhaps,we should read:G reen ,M.S.:2000.“Illocutionary force and semantic content”.Linguistics and Philosophy 23(5):435–473(28)Task:compare all the di fferent devices on various kinds of embedding:a.John believes that ...b.Mary stayed home because ...c.If ...,the debate will be di fficult.d.&c.Lecture Notes ::Part 1::Version 1.1::February 9,2003::21:32:373Modes of Assertion::24.910::MIT Spring2003Kai von Fintel1.4More ComparisonsCompare to performatives:(29)I promise youfive dollars if you mow the lawn.(30)I pronounce you husband and wife.(31)I christen this ship“Prunella”.Compare to modal expressions:[...]1.5Evidentials(32)A nderson’s D efinition of“E videntials”(from Anderson1986)a.Evidentials show the kind of justification for a factual claim whichis available to the person making the claim.b.Evidentials are not themselves the main predication of the clause,but are rather a specification added to a factual claim about some-thing else.c.Evidentials have the indication of evidence as their primary mean-ing,not only as a pragmatic inference.d.Morphologically,evidentials are inflections,clitics,or other freesyntactic elements(not compounds or derivational forms).(33)T ypes of S ources of I nformation(from Willet1988)a.Direct–Attested–Visual/Auditory/Other Sensoryb.Indirect(i)Reported–Secondhand/Thirdhand/Folklore(ii)Inference–Results/ReasoningLecture Notes::Part1::Version1.1::February9,2003::21:32:374Modes of Assertion::24.910::MIT Spring2003Kai von FintelQuechua(34)-mia.Pilar bread-mi ateb.Woman-mi totally jumps aroundc.Lima-mi she travelled.d.Not-mi in my backpack it is.e.In the rainforest-mi,there are monkeys.f.In Africa-mi,there are elephants.(35)-cháa.Pilar know-house-chábe.(‘know-house’=school!)b.There is no rain.Now year not-chágood harvest be.(36)-sia.Marya knwo-house-si beb.some-si hit him(37)No evidentialPilar bread ate.Tibetan(38)Egoa.I teacher ego-beb.Yesterday I to his house ego-went(39)Directa.He left-directb.He now food eat-direct(40)Indirecta.He left-indirectb.today here wome tasty very indirect-ELPALecture Notes::Part1::Version1.1::February9,2003::21:32:375Modes of Assertion::24.910::MIT Spring2003Kai von FintelW riting A ssignment.Due:Feb25.Probably fairly short.Compare Quechua,Tibetan,and English with respect to the following three scenarios:A.You look out the window and see pouring rain.B.You see people in the hallway with dripping umbrellas.C.You wake up and the weather report on the radio says there is pouring rainin Cambridge.Which of the following English sentences can you use in which of the scenarios: (i)It’s raining.(ii)It must be raining.(iii)It’s raining,I guess.(iv)It’s raining,I hear.Based on the descriptions you have read so far(Chapter1of both theses),which constructions from the two languages could you use in these scenarios?Justify your answers by quoting or paraphrasing the relevant descriptions.What relevant differences,if any,emerge between the three languages?R eading A ssignment:Faller,Chapter2“Evidential Hierarchies”I myself will also be reading:•F aller,Martina:to appear.“The Evidential and Validational Licensing Conditions for the Cusco Quechua Enclitic-mi”.Belgian Journal of Lin-guistics•F aller,Martina:2002.“Remarks on evidential hierarchies”.In David I.B eaver,Luis D.Casillas M artínez,Brady Z.C lark&Stefan K auf-mann,editors,The Construction of Meaning,CSLI,Stanford.•D endale,Patrick&T asmowski,Liliane:2001.“Introduction:Eviden-tiality and Related Notions”.Journal of Pragmatics33:339–348•P lungian,Vladimir A.:2001.“The Place of Evidentiality within the Universal Grammatical Space”.Journal of Pragmatics33:349–357Lecture Notes::Part1::Version1.1::February9,2003::21:32:376。

21F.402 "Das Lied der Deutschen" GE 006 "Einigkeit, Recht und Freiheit"Hören Sie sich die Cassette GE 006 an. Sie hören einen kurzen Vortrag über die Geschichte der Melodie und des Textes der deutschen Nationalhymne. Versuchen Sie beim Zuhören, die fehlenden Daten und Namen aufzuschreiben.Der Text des Lieds finden Sie auf Seite 312 in Ihrem Buch (Neue Horizonte).• im Jahre _____________ zogen unter Napoleon die französischen Truppen nach Wien.• im Jahre ______________ kehrte ________________________ aus England zurück. Er sollte zu einem Gedicht eine Melodie komponieren. Die neue Hymne spielte man zum ersten Mal am Geburtstag des ______________________________ .• bis zum Jahre ____________ blieb dieses Lied die österreichische Nationalhymne.Die Melodie hatte er aus England mitgebracht, wo er sie in Henry CareysHerrscherhymne zuerst gehört hatte.• im Jahr ___________ schrieb der Komponist auch sein Opus 76, nr.3 und schrieb Variationen an der Melodie. Diese Musik ist heute noch bekannt als das____________________________.• am _________________________ schrieb August Heinrich Hoffman von Fallersleben ein Gedicht, in dem er für sich und seine Leserschaft damals versuchte, die Frage zu beantworten, "Was ist Deutschland?"• im Jahre _____________ kaufte ein Hamburger Geschäftsmann "Das Lied der Deutschen vom Dichter und verkaufte es dann gleich 5 Tage später als populäres Lied mit der Melodie von ______________________.• Anfang des ________________ Jahrhunderts gehörte das Lied zu den meist gesungenen Liedern in Deutschland.• im Jahre _______________ erklärte der sozialdemokratische Reichspräsident _______________________________ "Das Lied der Deutschen" zur Nationalhymne der neuen Weimarer Republik• nach ______________ übernahmen die Nationalsozialisten die Hymne, aber man durfte nur die _______________ Strophe zusammen mit dem SA-Gesang "Die Fahne hoch" spielen.• ___________________ verboten die Alliierten das Lied der Deutschen zusammen mit anderen Nazi Liedern.。

PS 4 SolutionsQuestion 1You are studying the synthesis of the amino acid tryptophan in bacteria. The enzymes TrpA, TrpB, TrpC, TrpD, TrpE and AroH are all required for tryptophan synthesis. In the presence of tryptophan, wild-type bacteria do not synthesize any of these enzymes; however, in the absence of tryptophan, all of these enzymes are synthesized at high levels.a) Theoretically speaking, if the synthesis of the above enzymes is negatively regulatedi) what change to the repressor protein would cause the enzymes to be synthesized even in the presence of tryptophan?Inactivation of the functional repressor so that it cannot bind the operator.ii) what change in the operator sequence would cause the enzymes to be synthesized even in the presence of tryptophan?A mutation in the sequence of the operator such that it no longer binds the repressor.iii) what change in the repressor protein would cause the inhibition of enzyme synthesis, even in the absence of tryptophan?A change that increases the affinity of the repressor for the operator, i.e., a constitutively activerepressor.b) If the synthesis of the above enzymes is positively regulated,i) what change in the activator protein would cause the enzymes to be synthesized even in thepresence of tryptophan?A change that increases the affinity of the activator for the operator, i.e., a constitutively active activator.OR…A change in the activator such that tryptophan can no longer bind.ii) what change in the activator protein would prevent synthesis of the enzymes, even in the absence of tryptophan?A mutation in the sequence of the activator gene, such that a nonfunctional activator protein isproduced.iii) what change in the operator sequence would prevent synthesis of the enzymes, even in the absence of tryptophan?A mutation in the operator sequence rendering it unable to bind activator.c) By mutational analysis you identify two regions of DNA that are important in the regulation of tryptophan synthesis. The first of these regions, called trpR, is a gene that encodes a DNA-binding protein. The second region is a DNA sequence to which the trpR gene product binds, called trpO. Analysis of three bacterial strains with different genotypes at the trpR and trpO loci yields the following results:mRNA levels of trpA, trpB,Strain growth media trpC, trpD, and trpEtrpR+trpO+with tryptophan0.1%without tryptophan100%trpR–trpO+with tryptophan100%without tryptophan100%trpR+trpO–with tryptophan100%without tryptophan100%i) Is the control of tryptophan synthesis likely an example of positive or negative regulation?The synthesis of tryptophan is under negative regulation.ii) Is the protein made from the trpR gene an activator or a repressor?The trpR protein acts as a repressor.d) Experiments to monitor the presence or absence of enzyme made from the trpC, trpD, trpE and aroH genes in some isolated mutants yields the following results:mutantwt 1 2 3 4 5TrpC level with trp-----+without trp+-++-+TrpD level with trp-----+without trp++-+-+TrpE level with trp-----+without trp++++-+AroH level with trp-----+without trp+++-++i) List all mutants that have mutations which affect production of any functional TrpC?mutant 1, mutant4, and mutant 5ii) List all mutants that have mutations which affect production of any functional TrpD?mutant 2, mutant 4, and mutant 5iii) List all mutants that have mutations which affect production of any functional AroH?mutant 3 and mutant 5e) Is the above data consistent with the theory that any of these genes are in the same operon (and therefore under the control of a single promoter)? Why? Which genes would be contained in this operon?The absence of functional enzymes from three loci as in the case of mutant 4 suggests that several genes could be contained within a single operon. All genes of the operon would be under control of the same promoter, which in mutant 4 would is mutated and nonfunctional, resulting in no synthesis of any of these enzymes. This operon would contain the trpC, trpD and trpE genes.f) How could you explain mutant 5 in terms of regulatory mutations?Though in different regions of the DNA, both the trpC/trpD/trpE operon and the aroH gene could be under regulation of the same repressor protein trpR. Mutant 5 would have a mutation in the trpR gene that knocked out functional trpR repressor. Therefore all genes would be expressed both in the presence and absence of tryptophan.Question 2While working with mice as a UROP, you discover a very important catabolic enzyme. You make mutations in the gene encoding this enzyme such that the mutant enzyme is always active. Mice carrying this mutant gene show rapid and permanent weight loss with no other side effects. YOU HAVE DISCOVERED THE MAGIC BULLET THAT MILLIONS OF PEOPLE WORLDWIDE HAVE BEEN SEEKING FOR GENERATIONS! But… you need the human version of this gene.To begin, you choose to make a human genomic DNA library.a) In the space below, briefly outline how you would make a genomic DNA library in bacteria.Include the terms: genomic DNA, restriction enzyme, plasmid, ligation, transformation, petri plates,probe, and hybridize.1. Cut human genomic DNA with a restriction enzyme.2. Cut the plasmid vector that has a selectable marker (like ampicillin resistance) with the same restriction enzyme.3. Ligate the genomic DNA into the vector.4. Transform the ligation mix into E. coli.5. Plate the transformed E. coli onto solid medium in petri plate that contains ampicillin.6. Make a probe and hybridize it to DNA from the libraryYou are successful in finding the human homolog. You have pinpointed the colony that contains a plasmid, called plib1,with the human homolog. You isolate the plasmid, clone the gene and designate it the svelte gene. Ideally, you want to express lots of human enzyme so that you can do a complete biochemical study of the protein. Therefore, you need to move the svelte gene from the plib1 plasmid into an expression vector. You have a great expression vector, p7.01MIT , for use in E. coli. A diagram of the expression vector p701MIT and the plib1 are shown below with their unique restriction enzyme sites.b) You want to insert a DNA fragment containing both the svelte gene and the kanamycin resistance gene (kan R ) into the p701MIT expression vector.i) What enzyme(s) would you use to cut plib1 to obtain a single fragment containing both the svelte gene and the kanamycin resistance gene (kan R )? What size fragments would you get?Choice 1: SalI and BamHI: 1129 + 650Choice 2: StyI and BamHI: 1028 + 751ii) What enzyme(s) would you use to cut p701MIT ? What size fragments would you get?Choice 1: SalI and BamHI: 2996 + 205Choice 2: StyI and BamHI: 2495 + 706c) After ligation, you transform your new vector p701MIT containing both the svelte gene and the kan R gene into an E. coli strain.i) Prior to transformation, this strain of E. coli should be... (circle all that apply.)ampicillin resistant.ampicillin sensitive.kanamycin resistant.kanamycin sensitive.ii) How would you detect which cells have the vector containing the svelte gene?Plate the transformed cells on medium containing both ampicillin and kanamycin.iii) What is the advantage of including the kan R gene on the fragment that you cloned into p701MIT ?This allows you to select against any cell that was transformed with the vector alone (i.e., with a vector that did not carry any insert), or with the vector carrying the wrong insert.Question 3a) On the gel below, mark places where you expect to find bands. Label each band with the number of bases that the fragment would contain.For the BamHI and StyI cloning:500100020003000400025003500Sal IEcoRIEcoRI and SalIBamHIBamHI and StyI35233523222113021302169053124951028For the SalI and BamHI cloning:b)primer: 5’ GAGTATCAGT 3’c) What is the sequence of the newly synthesized DNA? 5’ GAGTATCAGTAGCGGGCCTTTACGCCCAGCATprimerQuestion 4You are a genetic counselor at a major Boston hospital. A couple (shown in the pedigree below as 1and 2) comes to you and wants to know what the probability is that the child they are expecting will have big ears.Recently, the gene that results in big ears was cloned and sequenced. The region flanking the ear size gene is shown below.a) You want to amplify this gene from each parent using PCR. Give the sequence of two primers for this PCR reaction. Label 5’ and 3’ ends.primer A: 5’ GTCCTGATTT 3’primer B: 5’ ATTGGACCTA 3’b) Below is a schematic of the same region. On the diagram below draw where each primer would bind.c) In a schematic like that in b) draw the DNA strands that would be present after 2 rounds of PCR.Include the primers where appropriate on each strand.5’GTCCTGATTTAAAGGC GGGTCTAATGCCTAGTAGGTCCAAT3’3’CAGGACTAAATTTCCG CCCAGATTACGGATCATCCAGGTTA5’ear size gene5'5'3'5'3'5'3'5'5'3'3'5'round 1round 25'3'5'5'3'5'3'5'3'5'3'5'Question 4, continuedA restriction map of this region is shown below:The PCR-amplified DNA from each family member was digested with Hind III, Nde I, andBgl II. The digested DNA was separated by gel electrophoresis and the results are shown below.d) Is the big-eared phenotype dominant or recessive over the normal phenotype? How did you determine this?The big-eared phenotype is recessive over the normal phenotype. From the gel, you can see that individual two has both the wild-type gene and the mutant gene. Individual two does not show the big-eared phenotype.e) Given this family pedigree and gel, what are the chances that individuals 1 and 2 will have a child with big ears? Please explain.Individuals 1 and 2 have a 50% chance of having a child with big ears.Ee X ee: 1ee (affected) : 1Ee (carrier, normal ears)5'3'5'3'EcoRI HinDIIINdeIBglIIwild-type3004005005'3'5'3'EcoRI HinDIIINdeImutant700500base pairs800600500400200Individual123546。

7.02 Microbial Genetics in Lab QuizFall, 2001September 27, 2001ANSWER KEYThis quiz contains 4 questions worth a total of 48 points.Be sure to write your name, Bench letter and Undergraduate TA’s (UTA) name on EACH page (2 points)GOOD LUCK!1.(12 points)What was the purpose of the following reagents in the Genetics module? A completeanswer will BRIEFLY describe when it was used in the module (what experiment) and what it is/how it works/what it does.MacConkey, Arabinose, Kanamycin (Mac Ara Kan) Plates:Mac Ara Kan plates were used to select/screen for putative Ara- mutants aftertransposon mutagenesis. Kanamycin selects for colonies that have received atransposon insertion anywhere in the bacterial genome. MacConkey and Arabinose were used to screen the KanR colonies for their Ara+/Ara- phenotype. MacConkey is an indicator dye that is sensitive to pH changes. When cells can metabolizearabinose (Ara+), the pH drops, and the MacConkey dye makes the colonies red.When cells cannot metabolize arabinose (Ara-), they use amino acids as a carbonsource instead. This raises the pH, and the colonies appear white/translucent.Plasmid pNK:Plasmid pNK was used during the transposon mutagenesis experiment. pNK is aplasmid that contains an IPTG-inducible transposase gene; this allows us to control the expression of transposase, and thus the “hopping” of the miniTn10 transposon into the genome. We needed to provide transposase on a plasmid because mini-Tn10 does not encode this enzyme. We could also stabilize our ara::lacZ fusions by moving them into a strain that did not contain pNK. (Stabilization would beimpossible if miniTn10 contained its own transposase.)Bacterial strain LE392:LE392 was used to determine the titer of λ1205. λ1205 contains an amber mutation in a gene required for DNA replication; this amber mutation usually preventsλ1205 from lysing bacterial cells. The LE392 strain contains an amber suppressor that “compensates” for the amber mutation in the phage, and therefore DNAreplication and bacterial cell lysis are restored. Note: LE392 does NOT restorelysogeny to λ1205!!2. (12 points)A wild-type E. coli strain was grown in minimal medium containing glucose and lactoseas carbon sources. Over time you followed the growth of the culture and obtained thegrowth curve shown below. At t1, t2 and t3 an aliquot of cells was obtained and assayed for β-galactosidase activity. At what time is β-galactosidase activity lowest? At whattime is ß-galactosidase activity highest? Justify your answer. (Hint: Use diagrams of the lac promoter/operator region, including the appropriate repressors and activators.)Answer: β-gal activity was lowest at t1, and highest at t3.Justification:1. When glucose and lactose are present (t1) cells will utilize glucose and the lacoperon will not be induced. Thus, no β-galactosidase protein is made. Lactose will be utilized by the cell (i.e. the lac operon will be transcribed) only after glucose has been used up (t3). This phenomenon is called catabolite repression.2. In the presence of glucose and lactose the lac operon is not transcribed for tworeasons:a. Lactose cannot enter the cell. Thus, the lac repressor LacI will bind to thepromoter region of the lac operon and prevent binding of the E. colitranscription machinery (RNAP).b. CAP cannot bind to the promoter, as cyclic AMP levels are low due tohigh levels of glucose present in the medium.3. At t3, all the glucose in the medium will have been used up, the lac operon will betranscribed and β-galactosidase will be produced. In the presence of lactose, the lac operon is transcribed for two reasons:a. The lac repressor LacI cannot bind to the promoter, as allolactose binds toLacI and prevents it from binding to the operator site.b. Due to the lack of glucose, cyclic AMP levels are high, allowing CAP tobind to the promoter. This is necessary for recruiting the E. colitranscriptional machinery to the promoter. These two events allow thetranscription of the lacZ gene, which encodes the enzyme ß-galactosidase. PLEASE NOTE A DRAWING OF THE PROMOTER UNDER THE DIFFERENT CONDITIONS WAS ALSO AN ACCEPTABLE ANSWER.3.(12 points)a) You have reason to believe that E. coli can metabolize sweetose, a sugar you recently discovered. Based on what you learned in 7.02 describe a strategy (in flow-chart form) to identify mutants defective in metabolizing this sugar.In order to identify mutants involved in the metabolism of sweetose, I would begin by mutagenizing the cells with transposon mutagenesis. (Other strategies of mutagenesis would work, but each has its own challenges.)E. coli BW140(Lac-)/plasmid pNK cells (Gene encoding transposase is found on plasmid pNK and is inducible by IPTG)Infect with λ1205 carrying mini-Tnλ1205 is a defective phage that serves as a delivery vehicle for mini-Tn10; mini-Tn10 contains Kan R gene and ‘lacZ)The screen and selection can be done on MacConkey Sweetose Kan plates. I will lookfor mutants that are no longer able to ferment sweetose. These colonies will be white because they are metabolizing amino acids in the media, raising pH, which turns the pH sensitive dye white.(You could also patch colonies on M9 Glucose and M9 sweetose plates and look for growth. Cells that grow on M9 Glucose and not on M9 sweetose are Sweetose-. However, it is very important that you don’t plate your initial transposon mutagenesis mixture directly on M9 sweetose - You will select against the mutant you are interested in identifying.)(Identifying the regulation of genes in response to the presence of sweetose throughlacZ activity is not necessary at this point, as it doesn’t directly indicate disruption of a gene involved in sweetose metabolism.)b) How would you changes this scheme if you knew that sweetose metabolism was essential in the life cycle of E. coli?If metabolism of sweetose is essential in the cell, a null mutation (which is what a transposon usually generates) would probably be lethal. In order to study mutations in genes that are involved in an essential process, it is necessary to study hypomorphs or conditional mutants. These types of mutations are generated by “milder” mutagens, such as chemical or UV mutagens. It is then important to screen these mutants underpermissive and non-permissive conditions (for conditional mutants) and look for asweetose- mutant, or to look for reduced function (possibly reflected by slower growthrates) in sweetose metabolism when compared to wild type cells (for hypomorphs.)4.(12 points)You want to determine the cotransduction frequency of markers a, b, and c using P1cotransduction mapping. To do this, Debbie has given you a suspension of E. coli that contains109 colony forming units/ml. Debbie has also made a P1 lysate with a titer of 109 pfu/ml.The 7.02 staff has determined that you’ll get the most cotransductants if you do the following:1. Use an MOI of 0.22. Plate 0.1 ml of the P1/cell mix per plate3. Plate 105 cells per plate.a) By what factor will you need to dilute the cells? (Show all calculations!)You want to plate 105 cells per plate, and 0.1 ml of cells per plate. You have a stock of cells with a titer of 109 cfu/ml. Therefore:1. want: 105 cells/0.1 ml 106 cells/ml (cfu)2. have: 109 cells/ml3. ____109/ml____ 103106/ml4. Therefore, you must dilute the cells by a factor of 103 (make a 1/1000 dilution).b) By what factor will you need to dilute the phage stock? (Show all calculations!)1. Want: MOI = 0.2 4. have pfu = 1092. MOI = ___pfu___ cfu = 106 (from part a)` 5. _____109 pfu____= 5x103cfu 2x105 pfu3. pfu= 0.2 x 106= 2x105 6. Therefore, you need to dilutethe phage stock 1/5000 (2x10-4)c) By using an MOI of 0.2, a high percentage of cells will receive no phage. Why didDebbie nevertheless insist that you use a low MOI rather than a high one, i.e. MOI=10?If the MOI is too high, a high percentage of E. coli cells will receive more than one P1 phage. However, only a small percentage of phage in the P1 lysate will be transducing phage. Thus, iftwo phage infect a bacterium, it is highly likely that one of the phage is wild-type. The bacterium will be lysed, and the transductant cannot be recovered.In the highly unlikely event that two transducing phage enter the bacterium simultaneously, mixed recombination between the two phage and the host genome could skew the outcome of the recombination mapping.。

21A.240Race and ScienceSpring 2004 MITPART 1:THE ALCHEMY OF RACE: MAKING AND UNMAKING SCIENTIFIC RACISM Lecture 5. March 4Summary of so far : Close weave between theories of race and ideas about proper or natural SEX/GENDER roles and behaviors. We’ve seen this all the way from earlypre-scientific ideas about race through Darwin on sexual selection up to eugenics.Concerns with measuring the relative worth of races — first through ranking on the great chain of being, then through craniometry, then through an assessment of their evolutionary “fitness.”We’ve looked at changing SUBSTANCES of race.Last time, we looked at the history of eugenics in the United States and in Britain, which showed us how ideas about “race” were articulated to ideas about NATION and CLASS. And today, I want us to look at two histories PARALLEL to eugenics. These are:1. history of race in early American anthropology and sociology (Baker, Boas)and2. histories of immigration, citizenship law (Jacobson)You’ll have noticed from the Jacobson readings on American nativism, and the American making of the term “Caucasian” as a scientific synonym for white, anthropological visions and revisions of race take place in political context of American debates about IMMIGRATION and CITIZENSHIP and more particularly about IMMIGRATION and CITIZENSHIP LAWSo, American anthropology comes into existence amidst anxieties and debates about racial categories and the political and legal debates about immigration.I want you to see these two histories as contexts for one another — looking at how racial categories created in public debate about immigration, for example, affected how anthropology took on the categories AND looking at how public discourse about immigration and citizenship drew from, ignored, or reshaped anthropological categories.In thinking about these two histories as mutually constitutive CONTEXTS, It’s useful to reflect on what W.E.B. Du Bois said about RACE: “perhaps it is wrong to speak of race at all as a concept, rather than as a group of contradictory forces, facts and tendencies” (Baker 1997: p. 112). This as a call to understand “race” not simply as an idea, but as a messy part of everyday life.So, If our past two classes have been trying to get you to think about how scientific articulations of race also have simultaneously spoken in the registers of gender,class, nation, and state, today, I want you to think about the relation between SCIENCE, RACE, AND LAW.Skin Color, Bodily Form: Laws of Science and Laws of the Land in the Context of Immigration, Assimilation and Early 20th-Century American AnthropologyJacobson, Matthew Frye. 1998. Race and American Nativism, from Anglo-Saxons and Others, 1840-1924. In Whiteness of a Different Color: European Immigrants and the Alchemy of Race. Cambridge: Harvard University Press, pp. 68-90.Stocking, George, Jr. 1994. The Turn-of-the-Century Concept of Race. Modernism/Modernity 1:1: pp. 4-16.Baker, Lee. 1997. Rethinking Race at the Turn of the Century: W.E.B. Du Bois and Franz Boas. In From Savage to Negro: Anthropology and the Construction of Race, 1896-1954. Berkeley: University of California Press, pp. 99-126.Boas, Franz. 1913. Changes in Bodily Form of Descendents of Immigrants. In Race, Language and Culture. New York: The Free Press/Macmillan, 1966, pp. 60-75.Jacobson, Matthew Frye. 1998. Becoming Caucasian, 1924-1965 & Naturalizationand the Courts. In Whiteness of a Different Color: European Immigrants and the Alchemy of Race. Cambridge: Harvard University Press, pp. 91-109, pp. 223-240.ANTHROPOLOGY AND SOCIOLOGYLet’s start with the Stocking piece:G. Stanley Hall, president of Clark University, remarking on a paper he heardin 1895 on "The Scotch-Irish in America"made it clear that much more was involved in the "commingling of bloods"than simply physical characteristics. "The combination of racial bloods is not amere matter of biology or physiology...because physical inheritance does notinclude mere physical mingling of the bloods, but [also] that subtleatmosphere of associations, of home traditions, of family recollections andideals and aims, that are so inseparable.""Blood"--and by extension "race"--included numerous elements that we wouldtoday call cultural; there was not a clear line between cultural and physicalelements or between social and biological heredityStocking is showing us how many, different, separate features of humansocial life are confused, conflated by Hall, mixed together.Stocking argues that there were four traditions of thinking about humandifference that were usedThe ETHNOLOGICAL: language, food, custom, etc,The LAMARCKIAN: inheritance of acquired characteristics, couldn’t distinguish between cultural and biological inheritance (before ideas about heredity). POLYGENISM: idea that God had created human groups separately EVOLUTIONISM: but with idea that some groups are more evolved than others.It was all of these that FRANZ BOAS was interested in demolishing.How?1. Separate biology from culture.2. Use Darwinian theory to refute Lamarck,3. Argue for the unity of humanity4. Argue that evolution does not imply ranking (that is an old great chain of being idea) and that cultures must be studied on their own terms.Let’s go back to Hall’s idea about"The combination of racial bloods is not a mere matter of biology or physiology...because physical inheritance does not include mere physical mingling of the bloods, but [also] that subtle atmosphere of associations, of home traditions, of family recollections and ideals and aims, that are so inseparable."Boas would SEPARATE these strandsRACE, LANGUAGE, and CULTURE have different histories.Boas is responsible for defining CULTURE in the way we think about it today. Before Boas, CULTURE meant opera, oil paintings — and only Europeans had it.But, having separated CULTURE from BIOLOGY, what did this make RACE for BOAS? See his 1913 article, in which he demonstrates that children of immigrants to US look different from their parents. (an intervention in immigration debates)What did RACE become for BOAS? PlasticWhat’s really tricky here is that RACE still exists for BOAS-MOVEOVER, RACE IS always negative for BOAS.This means that he’s still trapped in the game — that there is something there in biology; he’s still using the categories of his day (see Baker 119)W.E.B. DU BOIS had a different approach. What was it?“perhaps it is wrong to speak of race at all as a concept, rather than as a group of contradictory forces, facts and tendencies” (Baker 1997: p. 112).Race is fully sociological; invented in the context of power and inequality. (p.111).And THIS is where the context of IMMIGRATION LAW in the UNITED STATESduring this period comes in.IMMIGRATION AND NATURALIZATIONThe concept of race forged and re-forged in the context of who could count asa citizen capable of rational self-government and immigration debates.1840-1924, question of who could be a Citizen of the US depended uponwhether people were considered capable of self-government, organizedaround what we would now call regional/national identities (Germanic,Mediterranean, Hebrew, Irish, Italian, etc.) but which back then wereracialized identities.To “naturalize” — and note the word! Getting citizenship AS IF being born inUS (US grants citizenship on birth on land — not all nations do this; e.g.Germany):1790 “any alien being a free white person”1870 added “aliens of African nativity and persons of African descent”1882: Chinese Exclusion Act, explicitly excluded Chinese, (who had beencoming from Canton because of the Gold Rush in California) lasts until 1943[about when Japanese internment starts!))Celts, Hebrews, Italians becoming less white in terms of who should appearon shore, but more white in terms of who could be citizens (p. 75).Immigration Restriction League 1893 (p. 77).anti-miscegenation laws (some state laws on books until 1967, 1948 in CA) some of these laws specified that a US citizen woman, if shemarried an alien ineligible for citizenship would lose her citizenship(only other thing you lose citizenship for is TREASON)treated women as property of a “race”; white women property of whitemen.of a piece with anti-immigration laws, regulating “reproduction” of thenation and its favored constituents.also kept “races” distinct by forcing immigrant groups into their owncommunities, thereby reproducing communities of people who werejudged according to those categories.Davenport: nation as race at Cold Spring Harbor1907 gentlemen’s agreement: stopped immigration of Japanese people to US.1911 Dillingham Commission Report on Races and Peoples; used Blumenbach’s 5 races, but also recognized “45 races among immigrants coming to the US” (p. 78). (p. 79: quote of use in analyzing Boas 1913!!! [names the very categories he’s using]).Dillingham commission saw immigrants as parents of future Americans (since citizenship is conferred by birth!), and so inquired into their fitness to be included in national germ plasm (eugenic concern) (pp. 82-83).1924: Johnson Act: 2% quotas for immigrants based on 1890 census.After 1924, a shift from ranking specific “races” like “Mediterranean” or “Irish” to the beginning of the consolidation of a “Caucasian” racial formation; all these types BECOME Caucasian.“Caucasian” supposedly a more “scientific” term than “white” (more thanskin-deep) [Jacobson p. 94]Race politics get reorganized around black-white“as scientists asserted over and over that “Aryans,” “Jews,” “Italians,” “Nordics,” and the like were not races, their myriad assertions themselves all buttressed an edifice founded upon three grand divisions of mankind—‘Caucasian,’ ‘Mongoloid’, and ‘Negroid’ — whose differences by implication were racial” (Jacobson p. 103)“Races of Mankind” exhibit 1943: nationalities are not races, the Jews are not a race, etc. “what is an American?” EXHIBIT WAS A LESSON IN CIVICS. Naturalization and the CourtsWhy is whiteness so important, legally?it’s about assignation of property rightswhiteness AS property (Lockean property in self, and right to own property) legal disputes: “Hey, I’m white!”“Between the 1870s and the 1920s the court generated their own epistemology of race that drew from scientific doctrine, from popular understanding, from historical reasoning, from “common-sense ideas, from geography, from precedent” (p. 226 quote)Ah Yup 1878 applied to be white: judge said that he was Mongolian and couldn’t be CaucasianHalladjian 1909 Armenians judged white because they were “Caucasian” even if not “European” but their inclusion was still based on the “fact” they were lighter than many Europeans — like the Portuguese — and also that white meant anyone who wasn’t AfricanLet’s take a look in depth at two famous court cases in which people sought to be classified as “white/Caucasian” in order to “naturalize” as citizens. These demonstrate the slide between Aristotelian and Prototypicalclassification employed by those in power to consolidate social hierarchy (see discussion in Jacobson):Ozawa (1922): “you may be white, but you are not Caucasian” science Thind (1923): “you may be Caucasian, but you are not white” common-sense“‘Caucasian’ did accomplish something that the more casual notion of whiteness could not: it brought the full authority of science to bear on white identity.” (p. 94).。