JBBM-06-67-67-Restriction-free cloning

GenScript Quick T-A Cloning KitTechnical Manual No. 0224 Version 20061030I Description (1)II Kit Components (1)III Vector Description (1)IV Storage (2)V Quality Control (2)VI TA Cloning Procedure (2)VII Trouble Shooting (5)VIII Order Information (5)I. DESCRIPTIONQuick T-A Cloning Kit is designed for convenient cloning for PCR products with 3’-A overhang. Linear blunt plasmid was added one thymine base at its 3’-end following Eco RV digestion. It includes special quick ligation buffer. Reaction can be incubated for 30 minutes at 16℃. Lac Z report gene in the vector allows the blue-white screening based the principle of α-complement. Any sequencing primers used for the pUC57 are suitable for the sequencing of the pUC57-T vector.II. KIT COMPONENTSThe kit (SD0228) contains the following components:III. VECTOR DESCRIPTIONpUC57-T vector is designed for convenient cloning for PCR products with 3’-A overhang. Linear blunt plasmid was added one thymine base at its 3’-end following Eco RV digestion. Fig. 1 is the map and restriction sites of pUC57-T Vector.Fig. 1 Map of pUC57-T VectorSequencing Primers:Forward primer: M13 Forward (-41), DA0004Reverse primer: M13 Reverse (-48), DA0006.IV. STORAGEStore at -20℃.V. QUALITY CONTROLEach lot of pUC57-T Vector is tested with PCR Cloning and Screening. Results showed that the recombinant efficiency of the white colonies is above 85%.VI. TA CLONING PROCEDUREA. Ligation1. Set up your ligation system as the following2. Add 5 μl of 2×Quick Ligation Buffer and mix.3. Add 1 μl of T4 DNA Ligase and mix th oroughly.4. Centrifuge briefly and incubate at 16℃ for 30 minutes.5. Chill on ice (Do not heat inactive).* Control insert is a size of 500 bp PCR fragment amplified by Taq DNA polymerase. The optimal mol ratio of insert and vector is 3:1 to 6:1.B. Transformation1. Briefly centrifuge the ligation reaction.2. Add 2 μl of the ligation reaction to 50 μl competent cell.3. Incubate on the ice for 30 minutes.4. Heat-shock at 42℃ for 2 minutes.5. Chill on ice for 3 minutes.6. Add 1 ml of LB to the tube, and then shake it at 200 rpm for 1 hour.7. Plate 50 μl of X-Gal/ IPTG Premix on the LB/Amp plates, dry it before use.8. Plate an appropriate amount of cells on the plates.9. Incubate the plates at 37℃ and grow overnight.C. PCR ScreeningPick white colonies to do PCR Screening with M13 Forward (-41) (DA0004) and M13 Reverse (-48) (DA0006). The following picture (Fig. 2) is our screening result when control insert of 500 bp is cloned into pUC57-T vector.Fig. 2 PCR Screening ResultD. SequencingSequencing the positive colonies with the following primers:Forward primer DA0004: M13 Forward (-41) (GGTTTTCCCAGTCACGAC)Reverse primer DA0006: M13 Reverse (-48) (AGCGGATAACAATTTCACAC) Fig. 3 and Fig.4 show the additional T base at 5’-end and 3’-end sequence of insert.Fig. 3 5’-end sequencing result of the cloned PCR productFig. 4 3’-end sequencing result of the cloned PCR productVII. TROUBLE SHOOTINGVIII. ORDER INFORMATIONQuick T-A Cloning Kit: Cat. No. SD0228For Research Use Only.GenScript Corporation120 Centennial Ave., Piscataway, NJ 08854Tel: 732-885-9188, 732-357-3839Fax: 732-210-0262, 732-885-5878E-mail: ******************Web: 。

GE HealthcarepGEX-4T-3GST Expression VectorProduct Specification SheetCode: 28-9545-52WarningFor research use only.Not recommended or intended for diagnosis of disease in humans or animals.Do not use internally or externally in humans or animals. HandlingThe vector should be removed from the dri-ice packaging and stored at -20°C. After thawing, centrifuge briefly to recover contents.ExpiryVector is stable for a minimum of 8 weeks from date of receipt when stored under recommended storage conditions.Safety warnings and precautionsAll chemicals should be considered as potentially hazardous. We therefore recommend that this product is handled only by those persons who have been trained in laboratory techniques and that it is used in accordance with the principles of good laboratory practice. Wear suitable protective clothing such as laboratory overalls, safety glasses and gloves. Care should be taken to avoid contact with skin or eyes. In the case of contact with skin or eyes wash immediately with water. See material safety data sheet(s) and/or safety statement(s) for specific advice. Components25 µg vector supplied in 10 mM Tris, 1 mM EDTA pH 8.0. Quality controlPurified plasmid will contain predominantly supercoiled format typically greater than 90% by agarose gel electrophoresis. Chromasomal DNA from the host is not observed. Plasmid is assayed to demonstrate presence of B am H1; Eco R I; Not I restriction endonuclease sites.ProtocolsPrepare fusion construct by inserting gene of interest into the multiple cloning site of pGEX-4T-3 using any one, or combination of unique restriction sites and transform into a host of choice such as E. coli BL21 (27-1542-01).Growth and Induction:1.Dilute an overnight culture transformed with pGEX fusionconstruct, 1:10 in fresh complex medium containing 100 µg/ml ampicillin. Grow the cells at 37°C to mid-log phase(A600 = 0.6–1.0). 2.Induce expression of fusion proteins by adding isopropyl-βD-thiogalactoside (IPTG) to 0.1 mM final concentration and allow the cells to grow for an additional 3–5 hours at 37°C.3.Expression of GST fusion proteins can be monitored using theAnti-GST Antibody (27-4577-01), GST Detection Modules(27-4590-01, 27-4592-01) or ECL GST Western Blotting Detection Kit (RPN1237).Preparation of cell extracts:1.Sediment the cells by centrifugation and resuspend in 1/20volume of PBS (PBS: 140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4,1.8 mM KH2PO4, pH 7.3).2.Lyse the cells by mild sonication or chemical lysis.3.Add Triton X-100 to a final concentration of 1% and mix gently atroom temperature (25°C) for 30 minutes to solubilize proteins. 4.Centrifuge the crude extract at 10 000 × g for 5 minutes at 4°C. PurificationThere are a range of Gluthatione Sepharose™ prepacked column and bulk media products available to purify GST Fusion proteins. For manual purification of sample volumes up to 600 µl use GST SpinTrap™ microspin columns or GST MultiTrap™ 4B 96-well plates. For sample volumes between 600 µl and 10 ml use GST GraviTrap™ gravity flow column. Where sample volumes are above 10 ml,use LabMate™ reservoir together with GST GraviTrap. All formats described can be used for preparation of samples in parallel. In addition GST HiTrap™ 1 and 5 ml columns and GST HiPrep™ FF16/10 column are available for purification in a chromatography system such as the ÄKTA™ design system. Alternatively, Gluthatione Sepharose bulk media are available from 10 ml up to 500 ml. A GST Bulk Kit is also available combining 10 ml Gluthatione Sepharose4B bulk medium and 5 empty columns with required buffers. For simplified buffer preparation use the GST Buffer Kit. Ordering information for all associated products is listed below.Site-specific proteolysis of fusion proteins:Separation of the recombinant protein from the glutathioneS-transferase moiety may be accomplished by site specific proteolysis using bovine thrombin (27-0846-01). Exact reaction conditions will vary with the nature of the fusion protein. The following conditions may be used as a guideline and should be optimized for each fusion protein: thrombin concentration, 0.2% (w/w) of fusion protein; reaction buffer, PBS; incubation temperature, 25°C; incubation time, 2–16 hours (1, 2).Multiple Cloning region and protease cleavage siteFor more information on the use of pGEX vectors, see GST Gene Fusion System Handbook.Intracellular expression of some eukaryotic proteins in Escherichia coli can lead to the formation of inclusion bodies (2). Increased solubilities can be obtained by lowering the growth temperature from 37°C to 28–30°C (3). Shortening the induction period may also improve results. Exact conditions must be established for each protein.imagination at workThe following primers for double-stranded sequencing of pGEX vectors are available: 5’ pGEX Sequencing Primer (bases 869–891)and 3’ pGEX Sequencing Primer (bases 1020-998).Further information relating to DNA sequence, restriction maps and control regions can be found at: References1. Smith, D. B. and Johnson, K. S., Gene 67, 31 (1988).2. Eaton, D., et al., Biochemistry 25, 505 (1986).3. Schein, C. H. and Noteborn, M. H. M., Bio/Technology 6, 291 (1988).4. Smith, D. B. and Corcoran, L. M., Current Protocols , pg. 16.7.1 (1990).Related productsGST vector products Code No. pGEX-4T-2 (25 µg) 28-9545-50pGEX-5X-1 (25 µg) 28-9545-53 pGEX-5X-2 (25 µg) 28-9545-54 pGEX-5X-3 (25 µg) 28-9545-55 pGEX-2TK (25 µg) 28-9546-46 pGEX-6P-1 (25 µg) 28-9546-48 pGEX-6P-2 (25 µg) 28-9546-50 pGEX-6P-3 (25 µg) 28-9546-51 pGEX-2T (25 µg)28-9546-53 pGEX-1λT EcoR/BAP (5 µg)28-9546-56pGEX 5’ Sequencing Primer5’-d[GGG-CTGGCAAGCCACGTTTGGTG]-3´ 27-1410-01 pGEX 3’ Sequencing Primer 5’-d[CCG-GGAGCTGCATGTGTCAGAGG]-3’ 27-1411-01 E. coli BL21 1 vial27-1542-01 GST purification products Code No. GST GraviTrap (10 columns) 28-9523-60 LabMate PD-10 Buffer Reservoir (50) 18-3216-03 GST Buffer Kit 28-9523-61 GST Bulk Kit27-4570-01 GST SpinTrap (50 columns)28-9523-59 GST MultiTrap 4B (4 × 96-well plates) 28-4055-00 GST MultiTrap 4 FF (4 × 96-well plates) 28-4055-01 GSTrap 4B (5 × 1 ml) 28-4017-45GSTrap 4B (100 × 1 ml)1 28-4017-46GSTrap 4B (1 × 5 ml ) 28-4017-47GSTrap 4B (5 × 5 ml) 28-4017-48GSTrap 4B (100 × 5 ml)1 28-4017-49Glutathione Sepharose 4B (10 ml) 17-0756-01Glutathione Sepharose 4B (100 ml) 17-0756-05Glutathione Sepharose 4B (300 ml)17-0756-041 Pack size available by specific customer order.GST detection product Code No. GST Detection Module 27-4590-01GST Detection Module (96-well format) 27-4592-01 Anti-GST Antibody27-4577-01 ECL GST Western Blotting Detection Kit RPN1237 Site-specific ProteasesCode No. PreScission Protease (500 units) 27-0843-01Thrombin (500 units) 27-0846-01Factor Xa (400 units)27-0849-01Lysis kitCode No.Yeast Protein Extraction Buffer Kit 28-9440-45Mammalian Protein Extraction Buffer 28-9412-79LiteratureCode No.GST Gene Fusion System Handbook 18-1157-58Recombinant Protein Purification Handbook 18-1142-75Affinity Chromatography Handbook18-1022-29LegalGE, imagination at work and GE Monogram are trademarks of General Electric Company.ÄKTA, ECL, GraviTrap, HiTrap, HiPrep, LabMate, MultiTrap, Sepharose and SpinTrap are trademarks of GE Healthcare companies. pGEX vectors: pGEX vectors are to be used for scientificinvestigation and research and for no other purpose whatsoever and a license for commercial use of the licensed products and processes claimed in US patent 5,654,176 and equivalent patents and patent applications in other countries must be negotiated directly with Millipore Corp (formely Chemicon International Inc) by the purchaser prior to use.All third party trademarks are the property of their respective owners.© 2009 General Electric Company – All rights reserved. First published June 2009All goods and services are sold subject to the terms and conditions of sale of the company within GE Healthcare which supplies them. A copy of these terms and conditions is available on request. Contact your local GE Healthcare representative for the most current information.For your local office contact information, visit /contact GE Healthcare UK Limited Amersham PlaceLittle Chalfont, Buckinghamshire, HP7 9NA, UK GE Healthcare offices:GE Healthcare Bio-Sciences AB Björkgatan 30, 751 84 Uppsala, SwedenGE Healthcare Europe GmbHMunzinger Strasse 5, D-79111 Freiburg, GermanyGE Healthcare Bio-Sciences Corp.800 Centennial Avenue, P.O. Box 1327, Piscataway, NJ 08855-1327, USAGE Healthcare Bio-Sciences KK Sanken Bldg. 3-25-1, Hyakunincho, Shinjuku-ku, Tokyo 169-0073, Japan2895958628-9545-52PS AA 06/2009。

4. Select a transformant with the correct restriction pattern and use sequencing to confirm that your gene is cloned in the proper orientation.
5. Transfect your construct into the mammalian cell line of interest using your own method of choice. Generate a stable cell line, if desired.
pcDNA™3.1(+) pcDNA™3.1(–)
Catalog nos. V790-20 and V795-20 Version J 5 August 2008 28-0104
User Manual
ii
Table of Contents
Important Information........................................................................................................................v Accessory Products ............................................................................................................................vi
Appendix...................................................................................................................... 10

pHIS2 载体pHIS2 is a reporter vector that can be used in yeast one-hybrid assays to identify and characterize DNA-binding proteins. The vector was specifically designed for use with the BD Matchmaker™ One- Hybrid Library Construction & Screening Kit (#K1617-1). It contains a HIS3 nutritional reporter gene, located downstream of a multiple cloning site (MCS) and the minimal promoter of the HIS3 locus (PminHIS3). Cis-acting DNA sequences, or DNA target elements, can be inserted into the MCS and used as baits to screen GAL4 AD/cDNA fusion libraries for proteins that interact with the target sequence.A protein-DNA (or one-hybrid) interaction can be detected by performing the assay in a yeast strain such as Y187 that is auxotrophic for histidine. Positive one-hybrid interactions drive expression of the HIS3 reporter gene, which enables the host cell to grow on histidine-deficient media.In the absence of activation, the constitutive HIS3 expression from PminHIS3 is very low. During library screening, the leaky expression of HIS3 is controlled by adding3-amino-1,2,4-triazole (3-AT) to the medium. The concentration of 3-AT needed to fully suppress leaky HIS3 expression must be determined empirically for each DNA target element.pHIS2 can be maintained in both yeast and bacteria. It contains an autonomous replication sequence (ARS4) and TRP1 nutritional marker for replication and selection in yeast (1, 2); it contains a Col E1 origin and a kanamycin resistance gene (Kanr) for propagation and selection in E. coli. The centromeric sequence CEN6 ensures proper segregation of the plasmid during cell division in yeast (1, 2).载体应用To use pHIS2 in a one-hybrid assay, clone one or more copies of a cis-acting DNA target sequence into the MCS. Then introduce the plasmid into competent yeast cells using the transformation protocol in the BD Matchmaker Library Construction & Screening Kits User Manual (PT3529-1). In contrast to the original BD Matchmaker One- Hybrid System, this reporter vector does not need to be integrated into the yeast genome. Instead, it is maintained as an episome throughout the assay. Inserting your target element may alter the level of background HIS3 expression. Therefore, constructs should be tested for background (leaky) HIS3 expression before you start a one-hybrid analysis. Background growth due to leaky HIS3 expression is controlled by adding 3-AT to the selection medium, as described in the User Manual (PT3529-1).。