Differentiation between Cyprinid herpesvirus type-3 lineages using duplex PCR--鲤鱼疱疹病毒3型
- 格式:pdf
- 大小:730.65 KB
- 文档页数:7
Journal of Virological Methods 158(2009)51–57Contents lists available at ScienceDirectJournal of VirologicalMethodsj o u r n a l h o m e p a g e :w w w.e l s e v i e r.c o m /l o c a t e /j v i r o m etDifferentiation between Cyprinid herpesvirus type-3lineages using duplex PCRL.Bigarréa ,∗,1,M.Baud a ,1,J.Cabon a ,1,J.Antychowicz b ,S.M.Bergmann c ,M.Engelsma d ,F.Pozet e ,M.Reichert b ,J.Castric aaPathologie Virale des Poissons,AFSSA,Technopôle Brest-Iroise,29280Plouzané,France bNational Veterinary Research Institute,Partyzantow 5724-100Pulawy,Poland cFriedrich-Loeffler-Institut,Federal Research Institute for Animals Health,Suedufer 10,D-17493Greifswald -Insel Riems,Germany dCentral Veterinary Institute of Wageningen,CIDC-Lelystad,Wageningen UR,PO box 65,8200AB Lelystad,The Netherlands eLaboratoire Départemental d’Analyses du Jura,BP 40135,39802Poligny,FranceArticle history:Received 11September 2008Received in revised form 15January 2009Accepted 20January 2009Available online 4February 2009Keywords:Alloherpesviridae KHV CyHV3Koi carp Duplex PCRa b s t r a c tTo date,all the isolates of Cyprinid herpesvirus type-3(CyHV3)responsible for serious outbreaks in carps Cyprinus carpio have been found to be very similar or identical on the basis of DNA sequences of a few reference genes.However,two genetic lineages (U/I and J)are distinguished by full-length genome sequencing.Two molecular markers presenting genetic variations were targeted for developing a duplex PCR assay able to distinguish CyHV3-U/I from CyHV3-J while avoiding DNA sequencing.The method was validated on a series of 42samples of infected carps from France,The Netherlands and Poland collected from 2001to 2008.Among these samples,both the U/I and J genotypes were identified,but also a third genotype representing a genetic intermediate between U/I and J for one of the two molecular markers.A classification of CyHV3genotypes,based on the alleles of the two molecular markers,is proposed.The assay is easy to perform and provides a genotype information with samples moderately or highly concentrated.This tool should improve our knowledge regarding the present distribution and future diversification of this emerging virus.©2009Elsevier B.V.All rights reserved.1.IntroductionCyprinid herpesvirus type-3(CyHV3,previously described as Koi herpesvirus)has been responsible for outbreaks resulting in high mortalities in the common carp Cyprinus carpio and its vari-ety koi,both in farms and the natural environment,worldwide.The affected fish exhibit frequently nephritis and necrosis of the gills,and abundant mucus production on the body.This devastat-ing virus has spread rapidly due to the movement of fish for trade or exhibitions (Haenen et al.,2004).Virus dissemination has been facilitated by its potential latency inside the host,which is influ-enced strongly by the temperature of the water (Gilad et al.,2003;St-Hilaire et al.,2005).Outside a temperature range of 16–28◦C,the fish does not exhibit any clinical signs while the virus persists and might be reactivated after a change in temperature within the indi-cated range.A highly sensitive diagnostic test is therefore needed to identify these carriers and thus avoid contact with healthy fish.The detection of carp antibodies or CyHV3antigens is the basis for ELISA tests.However,antibody levels become undetectable after∗Corresponding author.Tel.:+33298224982;fax:+33298055165.E-mail address:l.bigarre@afssa.fr (L.Bigarré).1Equal contributors.several months (Perelberg et al.,2008).ELISA tests do not differen-tiate between an infection caused by a virulent wildtype strain and a vaccination with an attenuated genotype (Perelberg et al.,2008).Further diagnostic tests have been carried out to detect the viral genome.CyHV3,classified within the Alloherpesviridae family,has the longest known genome among the species of the Herpesvirales order,with a double-stranded DNA of about 295kbp (Aoki et al.,2007;Hutoran et al.,2005).Several amplification methods have been developed to detect the viral DNA,targeting various regions of the genome by conventional PCR,nested-PCR,real-time PCR or loop-mediated isothermal amplification (El-Matbouli and Soliman,2007;Gilad et al.,2002;Gilad et al.,2004;Gray et al.,2002;Gunimaladevi et al.,2004;Soliman and El-Matbouli,2005).A con-ventional PCR based on targeting the thymidine kinase (tk )gene was shown to be specific to CyHV3and relatively effective in diag-nosing some,but not all,carrier fish after an infection challenge (Bercovier et al.,2005).The methods discriminate CyHV3from the other two Cyprinid herpesviruses,CyHV1and CyHV2.However,none of the proposed amplification methods is able to discriminate between genotypes of CyHV3,not only because they target deliber-ately the conserved domains of the genome but also because CyHV3isolates are very similar.This was concluded by aligning the three complete sequences obtained from isolates from Japan (CyHV3-J),0166-0934/$–see front matter ©2009Elsevier B.V.All rights reserved.doi:10.1016/j.jviromet.2009.01.02352L.Bigarréet al./Journal of Virological Methods158(2009)51–57United States(CyHV3-U)and Israel(CyHV3-I)(Aoki et al.,2007). They exhibited a DNA identity above99%.Another study compared nine isolates originating from two regions in Japan,one isolate from the United States and one strain from Israel in two∼450bp domains of the DNA polymerase gene and the major envelope pro-tein gene(Ishioka et al.,2005).It demonstrated perfect identity among the sequences.Similarly,a strong identity was found among isolates from Poland or from Germany(Antychowicz et al.,2005;El-Matbouli and Soliman,2007).Despite this close identity between isolates in selected regions,a few minor deletions/insertions and punctual mutations exist between the three complete sequences available.These variations allow distinction between CyHV3-J lin-eage(Japan)and a lineage represented by CyHV3-I(Israel)and CyHV3-U(United States)isolates(Aoki et al.,2007;Bercovier et al.,2005).The global distribution of both lineages is largely unknown.A simple molecular test distinguishing the two genotypes would help to provide data on the geographical prevalence of the two genotypes of this emerging virus.A duplex PCR assay was set up to distinguish the two CyHV3lineages known to date and provide thefirst data on their prevalence in three European countries.2.Materials and methods2.1.Fish maintenanceHealthy koi carps were obtained from a French farm with no history of CyHV3as demonstrated by regular analysis by PCR and the absence of mortality events.They were maintained at AFSSA in tanks supplied with freshwater at a temperature of23◦C.2.2.Viral isolatesThe CyHV3isolate F98/50from the US(sent to AFSSA by R.P. Hedrick,in2002)was passaged on Koi Fin(KF1)cell line(Hedrick et al.,2000)at least25times.The infected KF1cells were main-tained at24◦C in Eagle BHK21medium(Gibco),supplemented with Penicillin/Streptomycin,Glutamine and FCS10%(v/v).This iso-late is distinct from the American isolate CyHV3-U of2003which was used for full-length sequencing(Aoki et al.,2007).The CyHV3 isolates from France originated from dead koi carps following importation.Most of them were initially diagnosed CyHV3-positive by a regional laboratory of analysis(LDA39)according to the Gilad PCR assay(Gilad et al.,2002).Subsequently,the samples were sent to AFSSA and confirmed CyHV3-positive by another PCR method (tk gene,see below).Isolate07/108b,from a dead koi received at AFSSA in2007,was maintained in the KF1cell line.Samples from Poland and the Netherlands originated from koi carps and were diagnosed CyHV3-positive by tk PCR.DNA was sent to AFSSA in order to test the genotyping method.For CyHV1and CyHV2,total DNA was extracted at FLI from the cell culture supernatant and sent to AFSSA.For these two viral species,the presence of viral DNA was confirmed at AFSSA by a positive signal obtained after amplifica-tion of a362bp portion of the DNA polymerase gene with specific primers(not shown)(Jeffery et al.,2007).2.3.Persistence after experimental infectionForty-five koi carps(50g)were bath infected in100l of fresh-water at23◦C for2h using10ml of a supernatant of French isolate 07/108b maintained on KF1cells at24◦C and passaged seven times since its isolation from a koi carp in2007.Thefinal viral concentra-tion was4TCID50/ml.After2days,the temperature was increased to30◦C for one batch of40koi carps(group A),while a positive con-trol batch offive individuals(group B)was kept at23◦C.In group A,no mortality was observed and the carps were maintained for2months at30◦C and then back again to23◦C.Three individuals were isolated and maintained at23◦C.In order to verify the pathogenic-ity of the virus after this two-month period,one healthy koi carp was added to the three isolated individuals of group A at18days after the last temperature switch.Ten days after this introduction, the four koi carps died exhibiting typical symptoms.They were col-lected for PCR analysis.Ten controlfish(group C)were held in the same manner at23◦C using non-infected KF1cell supernatant.2.4.DNA extractionThe dead koi carps infected experimentally at AFSSA or obtained from dealers or private ponds in France were dissected and various organs(gills,heart,brain,kidney,spleen)were stored at−80◦C. The samples were thawed and total DNA was extracted with a‘DNA tissue’kit(Macherey-Nagel).DNA was eluted in100l of provided buffer and quantified by absorbance at260nm.2.5.CyHV3detection by amplificationThe three available full-length genomes were aligned and inspected visually for differences between the J lineage on the one hand and the U/I lineage on the other.A series of variable regions were noticed but few respected the three selected crite-ria compatible with a PCR test:(i)variations easy to detect by gel electrophoresis,(ii)sequence equilibrated in base composition and (iii)absence of short motifs repeated frequently prone to an excess of variation(for instance GT).Two regions(markers I and II)with deletions/insertions between lineages were targeted for amplifica-tion(Fig.1).Primers oPVP53/oPVP54are localized between ORF29 and ORF31of CyHV3-U(Aoki et al.,2007).These probes amplify a region(marker I)of168bp for CyHV3-J and only130bp for the other two sequences CyHV3-I and CyHV3-U.Primer oPVP55 is upstream ORF133of unknown function while oPVP56is within. These two primers target a region(marker II)of352bp in the Japanese sequence compared to278bp in the other two sequences.Duplex PCR was performed in50l with100ng of total DNA,0.4M of each primer oPVP53,oPVP54,oPVP55and oPVP56,1.5mM of MgCl2,200M of dNTP,and2.5U of TaqGold polymerase (Applied Biosystems).The following cycles were applied:1step of 5min at95◦C followed by40cycles at94◦C for30s,60◦C for30s, 72◦C for20s,and afinal extension at72◦C for5min.A volume of 20l was run on a Tris-Borate-EDTA(Invitrogen)2%agarose gel for 2h or alternatively on a precasted4%agarose E-gel(Invitrogen)for 30min.Some PCR products were cloned in TOPO-TA(Invitrogen) for sequencing.At least three clones per product were sequenced and aligned to obtain a consensus.Duplex PCR was compared with a PCR assay,based on the ampli-fication of a domain of the tk gene,used routinely at AFSSA.A domain of409bp within the tk gene was amplified with modifi-cations compared to the published method(Bercovier et al.,2005). Primers oPVP51(5 GGGTTACCTGTACGAGGTGA)and oPVP52(CAC-CCAGTAGATTATGCGCA),each at0.4M,were mixed with2mM of MgCl2,200M of dNTP and2.5U of TaqGold polymerase in afinal volume of50l.The cycles were identical to the duplex,except that the polymerisation step was30s.This tk domain was cloned in TOPO-TA to obtain a plasmid(tk-plasmid)useful for estimating the sensitivity of the tk assay.3.Results3.1.Proof-of-principleThe duplex PCR method was initially tested on the American isolate F98/50maintained in vitro on KF1cell line at AFSSA.Two products of about130and280bp were observed(Fig.2),whichL.Bigarréet al./Journal of Virological Methods 158(2009)51–5753Fig.1.Position of the duplex PCR primers in the genome of CyHV3-J (295052bp).In the frame,the name of the primer is followed by the position of its 5 end in the genome (Genbank AP008984).Below,the predicted size of the fragments amplified from three full-length sequences available in Genbank is indicated (not to scale).Motifs repeated within each region are underlined (see text).In bold,sequences present in CyHV3-J,absent in CyHV3-U/I.Two regions are deleted in CyHV3-U DQ657948)and CyHV3-I DQ657948)compared to CyHV3-J between oPVP53/54,and one in the region flanked by oPVP55/56.is fully consistent with the pattern predicted for markers I and II of the U/I lineage.Then,two recent samples from imported koi carps collected in France in 2007were tested.Interestingly,one isolate (07/108b)exhibited a pattern identical to F98/50while the other sample (07/179)had products of larger sizes,as expected for the CyHV3-J lineage (Fig.2).Therefore,the method was efficient in detecting the two known lineages and showed that both of them were introduced into France in the same year 2007.The proposed method was further tested with samples from France which had been stored at AFSSA since 2001,and samples from Poland and The Netherlands isolated from 2006to 2008(Table 1).Only the U/I pattern was observed after a retrospective analysis of isolates from France (Table 1).In the cases where differ-ent organs of the same fish were analysed,the same pattern was obtained,indicating that a single genotype accumulated within the individuals (Table 1).Thus,from 2001till 2007,only the isolate 07/179,already mentioned above,exhibited a CyHV3-J genotype in France.Among the 12isolates from Poland,two exhibited the U/I pattern.Surprisingly,the other 10exhibited a marker II allele typical of the U/I lineage (278bp)combined with a product of inter-mediate size between 130and 168bp,thus different from the two known alleles of marker I (Fig.2).This new allele was found again in one Dutch isolate of the 21analysed,while eight isolates were of the U/I pattern and 12of the J pattern (not shown).Two other carp herpesviruses,namely CyHV1and CyHV2,did not exhibitanyFig.2.Duplex PCR with various carp herpesvirus isolates from France,USA,Germany and Poland.See Table 1for identification of CyHV3isolates.CyHVl and CyHV2DNAs were obtained from cell culture supernatant and were mixed with 100ng of healthy koi carp DNA for PCR.Products were run on a 4%precasted agarose gel stained with EtBr (Invitrogen);K healthy koi;H 2O PCR negative control;M PCR ladder (NEB).signal (Fig.2),indicating the specificity of the duplex PCR method for CyHV3.To clarify the structure of the new allele of marker I,the sequenc-ing of several cloned PCR products was performed starting from samples from Poland or The Netherlands.Marker I of the Dutch sample NL06023826provided a sequence strictly identical to the published U and I genomes (Aoki et al.,2007),while sample NL06023699was fully identical to the J clone (Fig.3).Consistent with its electrophoretic pattern,sample NL06023818was unique in that only one domain (in 5 )was absent compared to the J clone,while U/I differ from J due to two absent domains.Thus,NL06023818represents a genetic intermediate between U/I and J for this marker.Sequences of markers I of PL08/1and PL08/2were strictly identical to those of NL06023826and NL06023818respec-tively,as expected from their identical electrophoretic mobility.Concerning marker II,the sequences of the alleles from three sam-ples from Poland indicated perfect identity with the U/I clone (not shown).In conclusion,DNA sequencing confirmed the identity of the amplified products and provided an explanation regarding the unexpected size of marker I of several samples.3.2.SensitivityThe sensitivity of duplex PCR was compared with the method based on the tk gene amplification used at AFSSA.To estimate the absolute sensitivity of the tk gene PCR,a range of plasmid con-taining the cloned fragment of the tk gene was amplified with the associated primers (Fig.4B).In these conditions,125copies of the plasmid carrying the partial gene were detected,whereas others could detect the equivalent of only 30virions (Bercovier et al.,2005)by targeting the same genomic domain.To compare the duplex and the tk gene amplifications,a range of concentrations of DNA from an infected fish was amplified by both ing the two assays,a specific signal from 40pg of DNA extracted from an infected koi (isolate 07/108b)(Fig.4A)was produced.With a smaller quantity (8pg),no detection was observed with the tk gene while the duplex PCR produced only the higher of the two expected bands.In fact,it was observed consis-tently that the duplex was more efficient at low DNA concentrations in amplifying the higher product than the lower one (not shown).Duplex PCR is thus more sensitive than the tk assay but the eventual absence of a low molecular weight product after testing a sam-ple should be interpreted firstly as a low sensitivity rather than a genotypic indicator.54L.Bigarréet al./Journal of Virological Methods 158(2009)51–57Table 1Origin and PCR duplex pattern of CyHV3analysed in this study.Isolate Country MaterialYear PCR pattern F98/50US KF1supernatant (gift of Hedrick),maintained on KF12003I −−II −L8318F KF1supernatant,passaged from a Koi carp 2001I −−II −L8928F KF1supernatant,passaged from a Koi carp 2001I −−II −N10922F Koi (gills)2003I −−II −P9248-1F Koi (kidney,brain,spleen)2005I −−II −P9248-2F Koi (kidney,brain,spleen)2005I −−II −7608/01F Koi (gills)2007I −−II −(kidney,brain,spleen)2007I −−II −07/108b F Koi (kidney,brain,spleen,gills)2007I −−II −07/179F Koi (gills)2007I ++II +06011512NL Koi (kidney,gills)2006I ++II +06011562-2NL Koi (kidney,gills)2006I ++II +06012956-3NL Koi (kidney,gills)2006I ++II +06012956-5NL Koi (kidney,gills)2006I ++II +06021995NL Koi (kidney,gills)2006I −−II −06022482NL Koi (kidney,gills)2006I −−II −06022615NL Koi (kidney,gills)2006I −−II −06023188NL Koi (kidney,gills)2006I −−II −06023699NL Koi (kidney,gills)2006I ++II +06023818NL Koi (kidney,gills)2006I −+II −06023826NL Koi (kidney,gills)2006I −−II −06024066NL Koi (kidney,gills)2006I −−II −06024298-2NL Koi (kidney)2006I −−II −06033496-2NL Koi (Kidney)2006I ++II +06035264NL Ko (Kidney)2006I ++II +07002503-3NL Koi (Kidney)2007I ++II +07002503-5NL Koi (Kidney)2007I ++II +07002678-2A NL Common carp (kidney,gills)2007I ++II +07003616-1NL Common carp(kidney,gills)2007I ++II +07003616-2NL Common carp (kidney,gills)2007I −−II −07004726-1NL Common carp (kidney,gills)2007I ++II +07/5PL Koi 2007I −+II −07/6PL Koi 2007I −+II −07/22PL Koi 2007I −+II −07/23PL Koi 2007I −+II −08/17PL Koi 2008I −+II −08/19PL Koi 2008I −+II −08/2PL Koi 2008I −+II −08/5PL Koi 2008I −+II −08/59PL Koi 2008I −+II −08/1PL Koi 2008I −−II −08/3PLKoi2008I −−II −When known,the organ sampled is indicated in the right column.3.3.Detection of two genotypes in mixed DNAConsidering the worldwide spread of CyHV3and the frequency of fish of different origins being mixed together at koi shows or for trading purposes,infections of a single fish with different CyHV3genotypes are likely to occur.If the proposed method is reliable,it should therefore be able to detect different genotypes in a sin-gle animal.Thus,a mixture of two samples of DNA from koi carps,each one infected by one of the two different genotypes isolated in France,07/108b and 07/179,was tested with duplex PCR.Sur-prisingly,in addition to the four expected products on the same lane,two additional products were observed after electrophoresis,with six bands on the lane instead of four (Fig.5).It was hypothe-sized that these two additional products could indeed result from the matching of two alleles of the same domain,one with and the other without deletion,hybridized during the last renaturation step of PCR.These hybrids will migrate more slowly than any of their double-stranded corresponding alleles due to a non-hybridised single-strand domain and therefore will have an apparent higher molecular weight.To test this possibility,this artefact was tenta-tively reproduced as follows.The final PCR products obtained from both individual isolates were mixed at the same ratio,denatured by heat and renatured slowly at room temperature.This simple treat-ment was sufficient to provoke the appearance of the same two additional bands,compared to the control sample which was not heat-treated and exhibited the two expected pairs of bands.There-fore,a mixture of two distinct genotypes in a single fish,varying in both considered domains,will reveal a pattern of six products andFig.3.Alignment and proposed classification of a range of marker I alleles obtained in this study.Alignment includes three sequences found in Genbank (underlined)and five sequences from Poland (PL)and The Netherlands (NL).J:Japan,I:Israel,U:United States.L.Bigarréet al./Journal of Virological Methods 158(2009)51–5755parative sensitivities of two detection methods for CyHV3and absolute sensitivity of tk PCR.(A).The same samples of total genomic DNA from an infected fish were assayed according to two different amplification protocols.Decreasing amounts of genomic DNA from an infected fish (l000pg,200pg,40pg.8pg,1.6pg and 0pg)were adjusted to l00ng with DNA from a healthy koi carp (respectively lanes 1–6).(B).Absolute sensitivity of tk PCR.Healthy koi DNA (l00ng)was mixed with various quantities of plasmid (number of copies)carrying the cloned tk domain.M PCR ladder (NEB);H 2O negative tk PCR control.Gel is 2%agarose stained with EtBr after electrophoresis.not four.No double infection was detected among the 42samples analysed.3.4.Stability of the markers during in vivo viral infectionThe stability of the markers was tested over time during the two-month period of infection of the same isolate 07/108b in vivo .All koi carps bath-infected and maintained at 23◦C (group B)died 11days after infection.No carp of the negative control group C died.As expected,all koi carps from group A,bath-infected like group B,survived during their maintenance at 30◦C.However,28days after a temperature switch from 30to 23◦C,a batch of three fishes delib-erately isolated from group B died,as well as a healthy koi carp in contact for ten days with these individuals.Total DNA was extracted from these four dead fishes and amplified with duplex PCR (Fig.6).The result was that the same genetic pattern was observed among the four samples and the initial inoculum over the infection period.Therefore,neither of the two genetic markers seemed to be modi-fied by the in vivo conditions overtime.Fig.5.PCR duplex with single or combined total DNA from different ne 1:Isolate 07/ne 2:Isolate 07/ne 3:mixture of isolate 07/108b and 07/ne 4:products of lane 1and 2were mixed and ne 5:same as lane 4except that products were heated and cooled before elec-trophoresis (see results).Lane 6:DNA from a healthy carp.Arrow heads:design hybrids of heterologuous strands (see text).Gel is 2%agarose stained with EtBr afterelectrophoresis.Fig.6.Duplex PCR on CyHV3-infected fishes dead after ne 1:Healthy fish (control);lanes 2–4:fishes dead after 2months at 30◦C and 28days at 23◦C;lane 5:fish dead after contact with fishes of lanes 2–4;lane 6:control =french isolate 07/108b (used for infection of fishes 2–5);lane 7:control =french isolate 07/179.Gel is 2%agarose stained with EtBr after electrophoresis.4.DiscussionCyHV3has spread on a large geographic scale in a short time.To date,poor genetic variability has been noticed indicating that a sin-gle strain,with variants,did disseminate rapidly.It would be helpful to trace these variants using molecular markers.For the human Herpes simplex virus type-1(HSV1),several methods have been described to detect polymorphism,including restriction fragment length (RFLP)(Norberg et al.,2006),sequencing of genes (Nagamine et al.,2000;Norberg et al.,2004),or sequencing of regions contain-ing variable numbers of direct repeats (Umene et al.,2008).For a first polymorphism test applied to CyHV3,probes were chosen at the borders of two of the very few deletions/insertions in order to set up a simple PCR assay able to distinguish the two lineages iden-tified so far.The test was effective in amplifying and comparing an American isolate and a series of European field genotypes.The results obtained demonstrate that a classification of CyHV3genotypes according to their geographical origin is not justified.Therefore,a classification based on the three variable domains within the two genetic markers I and II is tentatively proposed.The (+)and (−)symbols were used to indicate respectively the presence and absence of each of the three variable domains,according to its position in the 5 3 orientation of the complete genome.The U/I56L.Bigarréet al./Journal of Virological Methods158(2009)51–57lineage was designed as I−−II−,since the5 and3 domains were respectively absent within marker I,as well as the domain within marker II.Other CyHV3genotypes found in the present study were designed as I++II+or I−+II−(Table1).It should be mentioned that the major glycoprotein gene of isolate NL06023818was sequenced and exhibited100%identity to the sequences of CyHV3-I,U,J although its duplex pattern was different from those three genotypes(not shown).The duplex PCR was successfully used for an isolate from the US maintained in vitro and presented a pattern consistent with what is expected of the sequence of the American isolate of2003(Aoki et al.,2007).This result validates the potential of the method as well as demonstrating some stability in the genetic markers I−−II−in vitro in the described conditions.For HSV1,some variable markers were found stable in vitro while others showed too much insta-bility to be reliable(Maertzdorf et al.,1999).Meanwhile,in vivo genetic stability was observed for CyHV3between an inoculum and the recovered virus over three-months covering a viral persistence period followed by the disease.Therefore,genomic rearrangement events,such as deletions/insertions,in the two considered regions are scarce,although it has already happened once since both lin-eages have clearly the same ancestor.Within marker I,it is likely that the two variable domains are not rearranged simultaneously, but rather independently since a genotype with only one domain present was found.Unfortunately,it was not possible to challenge the stability of the markers in vitro or in vivo of a genotype I++II+. However,CyHV3-J was isolated in1998and its sequence,published in2007(Aoki et al.,2007),matched perfectly with the pattern of alleles obtained for isolate07/179.Therefore,the markers seem to show some stability during that period.This tendency is clearly an advantage because a marker which evolves does not provide enough information when tracing the source of an isolate.The proposed duplex PCR relies on the amplification of two markers in distant regions of the genome.This distance increases the chance of detecting new variants which have not yet been identified or even recombinants.For HSV1,mixed infections in an individual may give rise to recombinants and create polymorphism (Umene,1999).In view of this,it would be pertinent to analyse the vaccinal strain of CyHV3,which results from a series of passages and a UV treatment to force mutations(Perelberg et al.,2005).In the event of a particular pattern of the vaccinal strain,it would be of interest to infect vaccinated carps with a wild-type strain and anal-yse by duplex PCR the potential of thesefishes to produce wild-type or recombinant viruses.On comparing our protocol for the detection of the tk gene able to detect125copies of the target,the duplex PCR method proved to be just as sensitive,at least for the tested U/I lineage.In comparison, real-time PCR is much more sensitive with a lower limit10copies of tk-plasmid(Gilad et al.,2004).The tk detection presented here is apparently less sensitive than the original method(Bercovier et al.,2005).This difference in sensitivity could be due to changes in the used protocol compared to the one published,or different con-formational constraints between a full-length genome and a short domain inserted in a circular vector,or very possibly to the addi-tion of total DNA from healthyfish in the present assay.In fact,it was noticed that total DNA,at least above100ng,had an inhibitory effect on PCR(not shown).In conclusion,the new duplex PCR is at least as sensitive as the modified method based on the detection of the conserved tk gene and which can detect the equivalent of125copies of the genome.Duplex PCR is more informative and can be used routinely and simultaneously for detection and genotyping infishes carrying moderate to high viral loads.For poorly concentrated samples,more sensitive methods should be used,such as real-time PCR or nested PCR,which may detect less than10copies of a viral genome(Gilad et al.,2004).It should be mentioned that differences were detected between lineages U and I,when comparing the complete sequences. Unfortunately,most of them were subtle and would have required DNA sequencing,which was not the aim of the present test.It is expected that CyHV3diversification will occur in the future and that more genetic regions will provide targets for strain differentiation.The high conservation levels of markers I and II make them good candidates to be adopted as“common-type variations”as defined for those used in differentiating HSV1(Umene et al., 2007).Common-type variations are concentrated in hypervariable regions which include tandem-repeated sequences.CyHV3-J has such a directly repeated motif(reiteration CCTCAACCCCGGCAG) within the marker demarcated by primers oPVP53/54(named here common-type variation I)whereas it is present at only one copy in the two other genome sequences.This motif is not repeated else-where in the genome and contains a hexanucleotide CCCCGG whose complementary inverted sequence(CCGGGG)is also present in one of the reiteration structures of HSV1(Umene et al.,2007).Con-cerning the second marker limited by oPVP55/56(common-type variation II),a tandem repeat of69nt has been detected in CyHV3-J,without either a motif similar to the common-type variation I,or a CCCCGG sequence.Only one copy exists in CyHV3-U/I.In con-clusion,for both markers,rearrangements are associated with a change in the copy number of a motif,unique to each marker.It is not known whether the motif has been duplicated or deleted during the rearrangement,or in other words,which genotype has evolved to produce the other one.It was possible to demonstrate that at least three lineages have been introduced into Europe since2001via imported koi carps.To date in France,CyHV3has only been detected in shops,farms or individual ponds,but never in carps in open water like in Indonesia or the United States(Bondad-Reantaso et al.,2007;Grimmett et al.,2006).Surveillance must be intensified to estimate if the virus is endemic in European regions.Further efforts in controlling the sanitary status of importedfish and identifying the sources in the event of an outbreak may still prevent the definitive introduction of the virus into the wild.AcknowledgementsThe authors wish to thank R.P.Hedrick for kindly providing the KF1cell line and an isolate of CyHV3,C.de Boisséson and V. Beven for DNA sequencing,and P.Rélot for providing koi carps.This work was supported partly by the region‘Bretagne’and the Epizone project of EU’s Sixth Research Framework Programme. ReferencesAntychowicz,J.,Reichert,M.,Matras,M.,Bergmann,S.,Haenen,O.,2005.Epidemiol-ogy,pathogenicity,and molecular biology of koi herpesvirus isolated in poland.Bull.Vet.Inst.Pulawy49,367–373.Aoki,T.,Hirono,I.,Kurokawa,K.,Fukuda,H.,Nahary,R.,Eldar,A.,Davison,A.J., Waltzek,T.B.,Bercovier,H.,Hedrick,R.P.,2007.Genome sequences of three koi herpesvirus isolates representing the expanding distribution of an emerging disease threatening koi and common carp worldwide.J.Virol.81,5058–5065. Bercovier,H.,Fishman,Y.,Nahary,R.,Sinai,S.,Zlotkin,A.,Eyngor,M.,Gilad,O.,Eldar,A.,Hedrick,R.P.,2005.Cloning of the koi herpesvirus(KHV)gene encodingthymidine kinase and its use for a highly sensitive PCR based diagnosis.BMC Microbiol.5,13.Bondad-Reantaso,M.G.,Sunarto,A.,Subasinghe,R.P.,2007.Managing the koi her-pesvirus disease outbreak in Indonesia and the lessons learned.Dev.Biol.(Basel) 129,21–28.El-Matbouli,M.,Soliman,H.,2007.Detection of Cyprinid herpesvirus-3(CyHV-3) DNA in infectedfish tissues by nested polymerase chain reaction.Dis.Aquat.Org.78,23–28.Gilad,O.,Yun,S.,Adkison,M.A.,Way,K.,Willits,N.H.,Bercovier,H.,Hedrick,R.P.,2003.Molecular comparison of isolates of an emergingfish pathogen,koi herpesvirus, and the effect of water temperature on mortality of experimentally infected koi.J.Gen.Virol.84,2661–2667.Gilad,O.,Yun,S.,Andree,K.B.,Adkison,M.A.,Zlotkin,A.,Bercovier,H.,Eldar,A., Hedrick,R.P.,2002.Initial characteristics of koi herpesvirus and development of a polymerase chain reaction assay to detect the virus in koi,Cyprinus carpio .48,101–108.。