大豆凝集素对肉鸡脂肪代谢和脂肪生成基因表达的影响
- 格式:pdf
- 大小:394.17 KB
- 文档页数:8
Effects of soy-lecithin on lipid metabolism and hepatic expression oflipogenic genes in broiler chickensJin Huang a,b ,Dandan Yang a ,Shudong Gao c ,Tian Wang a,⁎aCollege of Animal Science and Technology,Nanjing Agricultural University,Nanjing 210095,ChinabKey Laboratory of Animal Physiology &Biochemistry,Nanjing Agricultural University,Nanjing 210095,ChinacEastocean oils &grains industries (Zhangjiagang)Co.,Ltd.,Zhangjiagang,215634,ChinaReceived 16June 2007;received in revised form 4January 2008;accepted 13January 2008AbstractThe purpose of this experiment was to determine the effects of soy-lecithin on the lipid metabolism and expression of lipogenic genes in the liver of broiler chickens.Arbor Acres (AA)chicks growing from 1to 42days of age were randomly divided into 4groups and fed corn –soybean basal diets containing 0%soy-lecithin (control),0.5%soy-lecithin (SL1),1%soy-lecithin (SL2),2%soy-lecithin (SL3),respectively.At the end of experiment,samples of serum were taken for analyses of metabolites/hormones and liver tissue was collected to quantify expression of selected genes.The abdominal fat was removed and samples of thigh muscle and breast muscle also were collected.The hepatic expression of the genes encoding malic enzyme (ME),fatty acid synthase (FAS),acetyl-CoA carboxylase (ACC),sterol regulatory element binding protein-1(SREBP-1),stearoyl-CoA (Δ9)desaturase 1(SCD1)and liver fatty acid binding protein (L-FABP)were determined with reverse transcription-polymerase chain reaction (RT-PCR)using SYBR green as a flourophore monitored in a real time mode.The study showed that the percentage of abdominal fat and liver fat were not significantly affected by soy-lecithin (P N 0.05).SL2group had the highest percentage of thigh muscle fat compared with other groups (P b 0.05),but soy-lecithin had no significant effect on the percentage of breast muscle fat and the width of inter-muscular fat (P N 0.05).Serum concentration of total serum cholesterol (TC)and low-density lipoprotein cholesterol (LDL-C)were reduced by soy-lecithin,whereas high-density lipoprotein cholesterol (HDL-C)and triglyceride (TG)were improved (P b 0.05).The thyroid-stimulating hormone (TSH)and insulin (INS)were elevated in SL3group (P b 0.05).Furthermore,abundance of ME,FAS,ACC,SREBP-1,L-FABP and SCD1mRNA were greater (P b 0.05)in SL3group.The results indicate that soy-lecithin alters the serum hormone levels and affects hepatic gene expression and thereby regulates fat metabolism of broilers.©2008Elsevier B.V .All rights reserved.Keywords:Soy-lecithin;Lipid metabolism;Gene expression;Liver;Chickens1.IntroductionAmong the ingredients used in poultry diets,fats and oils are the most concentrated sources of energy (Blanch et al.,1996),therefore,fats and oils are usually added to broiler diet as dietary energy-yielding ingredients to im-prove productivity.But fats utilization as energy source isAvailable online at Livestock Science 118(2008)53–60/locate/livsciCorresponding author.College of Animal Science and Technology,Nanjing Agricultural University,Nanjing,China.Tel.:+862584395106;fax:+862584395314.E-mail address:twang18@ (T.Wang).1871-1413/$-see front matter ©2008Elsevier B.V .All rights reserved.doi:10.1016/j.livsci.2008.01.014limited by young birds because of the lack of several digestion enzymes.Fats are not efficiently used until lipase activity reached its maximum level(Krogdahl and Sell,1989).Soy-lecithin is a by-product from the processing of soybean oil that,apart from being a source of energy,also serves as an emulsifier and has the potential to facilitate fat absorption(Lechowski et al.,1999). Studies have shown that dietary supplementation of bile salts improves emulsion formation and fat digestibility in chickens(Kussaibati et al.,1982;Polin et al.,1980a).In avian species,lipogenesis takes place primarily in the liver and the liver account for95%of the de novo fatty acid synthesis and there is apparently a general assumption that almost all the fat that accumulates in broiler adipose tissue is synthesized in the liver or is derived from the diet(Harry et al.,1992).The liver is the most important organ for the intermediary metabolism of lipids and energy and hence,regulation of hepatic gene expression may play a central role in the adaptive response to altered digestion by changing the capacity of enzymes in relevant metabolic pathways(Theil and Lauridsen,2007).The development of adipose tissue depends on the availability of plasma triglycerides that are hydrolyzed prior to their uptake by adipocytes and de novo synthesized fatty acids.They are supplied specifically to adipocytes by specific lipoprotein classes (Amal et al.,2002).Dietary phospholipids of soybean may affect hepatic triglyceride synthesis and in turn modify serum lipid profiles(Ristic et al.,2003).Thus,to determine the effects of soy-lecithin on lipid metabolism,we investigated changes in the levels of serum lipid profiles,key metabolic hormones and the expression of selected hepatic lipogenic genes.2.Materials and methods2.1.Animals and dietsTwo hundred and forty1-day-old male Arbor Acres(AA) chicks obtained from a local commercial hatchery(Hewei, Anhui,China)were randomly assigned to4treatment groups consisting of10replicates of6birds.The average initial body weight did not differ among the four groups.Chicken were fed corn–soybean basal diets and supplemented with0%soy-lecithin(control),0.5%soy-lecithin(SL1),1%soy-lecithin (SL2),2%soy-lecithin(SL3),respectively.The percentage of all other major ingredients remained similar across treatments.The diet was formulated to meet the nutrient requirements of the broiler(NRC,1994).The birds were fed a starter diet until21d of age followed by a grower diet from21to42d(Table1).Birds were allowed to consume both feed and water on an ad libitum basis and housed(six per cage)in an environmentally controlled room maintained at34–36°C during1to14days and thenTable1Formulation and analyzed content of diets1–21days21–42daysItem Cont.SL1SL2SL3Cont.SL1SL2SL3 Ingredient(%)Maize65.963.962.762.47169.868.768.6 Soybean meal28.528.728.92922.923.123.323.3 Fishmeal22222222 Soy-lecithin–0.5 1.0 2.0–0.5 1.0 2.0 Limestone powder 1.28 1.59 2.03 1.25 1.12 1.49 1.98 1.12 Dicalcium phosphate 1.74 1.73 1.79 1.77 1.5 1.62 1.53 1.5 Methionine0.200.200.200.200.140.140.140.14 Premixa a11111111 Salt0.380.380.380.380.340.350.350.34 Total100100100100100100100100 Analyzed content bME(MJ/kg)12.0012.0012.0012.2612.3012.3012.3012.55 Crude protein(%)20.4420.1320.4120.3218.1518.1818.318.17 Lysine(%) 1.10 1.09 1.13 1.080.940.960.950.95 Methionine+cystine(%)0.800.810.790.820.730.710.700.74 Calcium(%)0.98 1.01 1.02 1.010.890.900.850.90 Total phosphorus(%)0.700.720.690.700.620.650.660.64 Control=basal diet;SL1=basal diet with0.5%soy-lecithin;SL2=basal diet with1%soy-lecithin;SL3=basal diet with2%soy-lecithin.a Provided per kg of diet:iron,60mg;copper,7.5mg;zinc,65mg;manganese,110mg;iodine,1.1mg;selenium,0.4mg;Bacitracin Zinc, 30mg;Vitamin A,4500IU;Vitamin D3,1000IU;Vitamin E,20mg;Vitamin K,1.3mg;Vitamin B1,2.2mg;Vitamin B2,10mg;Vitamin B3, 10mg;choline chloride,400mg;Vitamin B5,50mg;Vitamin B6,4mg;Biotin,0.04mg;Vitamin B11,1mg;Vitamin B12,1.013mg.b ME(metabolic energy)was calculated from the composition of diets,others were analyzed content of diets.54J.Huang et al./Livestock Science118(2008)53–60reduced progressively to 26°C at the end of experiment.The light regimen was a 12-h light –dark cycle (06:00–18:00h light).2.2.Experimental procedureThe last day of the experiment,all chickens were fasted for 12h with free access to water before experimentation.The morning after,one chicken was then randomly selected from each pen replicate (40chickens,totally),weighed and killed by exsanguina-tion.Individual blood samples were taken and separated by centrifugation at 3000×g for 15min and at 4°C.Serum samples were frozen at −20°C for further analysis.Liver samples were removed and immediately frozen in liquid nitrogen and stored in a freezer at −70°C for subsequent extraction of total RNA.Thigh muscle and breast muscle were removed and stored at −20°C for the analysis of fat content.The abdominal fat was removed and weighed and the thickness of subcutaneous fat and the width of inter-muscular fat were measured using sliding caliper.2.3.Lipid extractionThe lipid of thigh and breast muscle was extracted according to the method of Folch et al.(1956).Meat samples (5g ±0.01)were homogenized with 100ml of chloroform –methanol (2:1,v/v)solution for 2min,filtered,placed in separator funnels and mixed with 20ml saline solution (0.88%KCl).After separation in two phases,the methanol aqueous fraction (top layer)was discarded,whereas the lipid chloro-form fraction (bottom layer)was washed with distilled water/methanol (1:1,v/v)and evaporated under nitrogen (N 2)flow.2.4.Serum measurementTotal serum cholesterol (TC),triglyceride (TG),high-density lipoprotein cholesterol (HDL-C),low-density lipoprotein cho-lesterol (LDL-C),free fatty acid (FFA)and serum glucose (SG)were measured by colorimetric enzymatic methods usingTable 2Sequences of PCR primers Gene a Accession number b Primer sequence (5′⟶3′)Orientation Product size (bp)ACC J03541TCTCGCTTTATTATTGGTT Forward 312CATTGTTGGCTATCAGGAC Reverse FAS J04485TGAAGGACCTTATCGCATTGC Forward 195GCATGGGAAGCATTTTGTTGT Reverse ME AF408407GCTGCAATTGGTGGTGCTTForward 106ACTCTGCTTTGCTGGTAGGATTG Reverse SREBP-1AY029224GCAGAAGAGCAAGTCCCTCAA Forward 104TCGGCATCTCCATCACCTC Reverse SCD1X60465TCCCTTCTGCAAAGATCCAG Forward 402AGCACAGCAACACCACTGAG Reverse FABP AF380999GAGCTCCAGTCCCATGAAAA Forward 202TCAGCAGCTCCATCTCACAC Reverse β-actinL08165TGCGTGACATCAAGGAGAAG Forward 300TGCCAGGGTACATTGTGGTAReverseaACC =acetyl-CoA carboxylase;FAS =fatty acid synthase;ME =malic enzyme;SREBP-1=sterol regulatory element binding protein-1;SCD1=stearoyl-CoA (Δ9)desaturase 1;L-FABP =fatty acid binding protein (liver).bGenbank accession number.Table 3Body composition of broilers fed with different level of lecithin after 42days ItemControl SL1SL2SL3Body (kg) 1.94±0.06a 1.85±0.04ab 1.96±0.06a 1.71±0.04b Liver (g)43.6±1.742.0±2.242.6±1.242.9±1.03Liver (%body weight) 2.19±0.53B 2.18±0.78B 2.19±1.1B 2.53±0.88A Abdominal fat pad (g)27.3±2.57ab 33.2±2.6a 28.0±3.3ab 22.7±1.6b Abdominal fat pad (%body weight) 1.40±0.11 1.72±0.17 1.46±0.18 1.40±0.06Subcutaneous adipose tissue (mm)0.82±0.03b 0.93±0.04a 0.86±0.04ab 0.90±0.04ab Inter-muscular adipose tissue (mm) 1.00±0.03 1.06±0.06 1.02±0.02 1.00±0.02Percentage of breast muscle fat (%) 4.54±1.13 4.41±0.8 3.48±0.87 4.00±0.87Percentage of thigh muscle fat (%)5.35±2.02b4.83±0.59b12.77±2.01a7.89±0.78bControl =basal diet;SL1=basal diet with 0.5%soy-lecithin;SL2=basal diet with 1%soy-lecithin;SL3=basal diet with 2%soy-lecithin.Values are means±S.E.n =10.Values in a row not sharing a superscripts are different at P b 0.05(small letter)or P b 0.01(capital letter).55J.Huang et al./Livestock Science 118(2008)53–60commercial kits purchased from Nanjing Jiancheng Bioengi-neering Institute (Nanjing,China).Triiodothyronine (T3),thyroxine (T4),thyroid-stimulating hormone (TSH)and insulin (INS)measured with the RIA kits provided by Beijing North Institute of Biotechnology (Beijing,China).2.5.Real-time quantitative PCR analysis of gene expression Total RNA was isolated using the TRIzol reagent (Takara,Japan)according to the manufacturer's protocol.The RNA integrity was assessed via agarose gel electrophoresis and RNA concentration and purity was determined spectrophotometri-cally using A 260and A 280measurements in a photometer (Eppendorf Biophotometer).Ratios of absorption (260/280nm)of all preparations were between 1.8and 2.0.Reverse transcription (RT)reactions (25μl)consisted of 2μg total RNA,100U of M-MLV reverse transcriptase (Promega,Belgium),40U of recombinat RNAsin ribonuclease inhibitor (Promega,Belgium),0.8mmol/l dNTP (Promega,Belgium),and 1μg random primers (Promega,Belgium)in distilled water and buffer supplied by the manufacturer.After incubation (37°C,60min),the mixture was heated (95°C,5min).Polymerase chain reaction (PCR)was performed in 25μl containing 2.5μl of the RT reaction products,12.5μl SYBR Real-time PCR Master Mix (TOYOBO,Life Science Depart-ment,Osaka,Japan),0.1–0.2mmol/l of each gene specific primer and β-actin,the internal standard (Table 2).The expression of β-actin had no significant difference among the four groups.Thermal cycling parameters were as follows:1cycle 95°C for 5min,and then 40cycles at 95°C for 30s,58–60°C for 30s,72°C for 20s on an STRATAGENE MX3000P ™Sequence Detection System (MXpro ™QPCR software).Fluorescence data was collected in the latter stage by recording SYBR incorporation into amplified DNA.Fluor-escent data were used to derive the C (t )or the PCR cycle at a threshold which is noted as the first significant deviation in fluorescence from a base line value.Analyses were performed in duplicate.The resultant value was expressed relative to β-actin (control gene).Results (fold changes)were expressed as 2−ΔΔC (t )with ΔΔC (t )=[C (t )ij −C (t )β-actinj]−[C (t )i1−C (t )β-actin1],where C (t )ij and C (t )β-actin j are the C (t )for gene i and for β-actin in a pool or a sample (named j )and where C (t )i 1and C (t )β-actin1are the C (t )in target gene and in house keeping gene in the control group,respectively.2.6.Data analysisData were analyzed by one-way ANOV A using the general linear models (GLM)procedure of SPSS 11.5software.Significant differences among individual group means were determined with Duncan's multiple range test option of the GLM procedure of SPSS software.Pearson correlation coefficients for the interrelationship of selected variables were determined using Bivariate Procedure of SPSS software.Values were expressed as mean±SE .3.Results and discussionThis study compared the effects of lecithin on the circulating levels of lipid profiles and keymetabolicFig.1.Serum concentrations of TC,TG,HDL-C,LDL-C in chickens fed diets containing 0%(Control),0.5%(SL1),1%(SL2)or 2%(SL3)of soy-lecithin in diets after 42days.V alues are means±SE,n =10.Means without a common letter are significantly different,P b 0.05.Control =basal diet;SL1=basal diet with 0.5%soy-lecithin;SL2=basal diet with 1%soy-lecithin;SL3=basal diet with 2%soy-lecithin.Table 4Serum parameters in broilers fed with different level of lecithin after 42days Item Control SL1SL2SL3T3(nmol/l) 1.46±0.17a 0.89±0.21b 1.26±0.19ab 1.44±0.16ab T4(nmol/l)33.4±827.0±1443.2±1033.9±5TSH (IU/l) 4.68±0.41a 5.42±0.05ab 4.64±0.44a 6.30±0.36b INS (m IU/l)0.12±0.00a 0.18±0.01a 0.20±0.01a 0.25±0.01b SG (mmol/l)7.90±0.887.71±0.30 6.73±0.3 6.69±0.55FFA (μEq/l)645±127656±57488±7563±111Control =basal diet;SL1=basal diet with 0.5%soy-lecithin;SL2=basal diet with 1%soy-lecithin;SL3=basal diet with 2%soy-lecithin.Values are means±S.E.n =10.V alues in a row not sharing a superscripts are different at P b 0.05.56J.Huang et al./Livestock Science 118(2008)53–60hormones and the expression of selected lipogenic genes in AA broiler chickens.Fats and oils are important dietary ingredients due to their high energy value,and their fatty acid pattern is to a great extent reflected in that of animal products (Duran-Montg et al.,2007).But the utilization of dietary fat is limited in young broilers because of the lack of several digestion enzymes (Krogdahl and Sell,1989).Phospholipids are known to have surface active properties.They are important in the emulsification of lipids and may influence the absorption of fatty acids in the small intestine (Jenkins et al.,1989).Fig.2.Hepatic ME (A),FAS (B),ACC (C),SCD1(D),SREBP-1(E)and L-FABP (F)gene expression in chickens fed diets containing 0%(Control),0.5%(SL1),1%(SL2)or 2%(SL3)of soy-lecithin in diets after 42days.RNA molecules extracted from liver were reversely transcribed to cDNA and analyzed by quantitative Real-time RT-PCR.For comparison between different samples,the ME,FAS,ACC,SCD1,SREBP-1and L-FABP transcript level of each sample was normalized for the β-actin level and expressed as a multiple of expression level of control,respectively.Values are means±SE,n =6.Means without a common letter are significantly different at P b 0.05(small letter).57J.Huang et al./Livestock Science 118(2008)53–603.1.Body compositionThe body weight of broilers in SL3group were de-creased(P b0.05)after42days intake of soy-lecithin (Table3).Soybean lecithin did not influence the liver weight of6-week-old broilers and the relative abdominal adipose tissue(%of body weight).By contrast,the relative proportion of liver(%of body weight)was significantly increased(P b0.01)and abdominal adipose tissue was decreased(P b0.05).The content of breast muscle fat and the width of inter-muscular adipose tissue was not affected by the addition of soy-lecithin(P N0.05) while the subcutaneous adipose tissue was improved in SL1group and the percentage of thigh muscle fat was significantly improved in SL2group(P b0.05).The relative weight of liver can be improved by soy-lecithin in broilers,and this is consistent with what was observed in a previous study(Wang et al.,1999).In avian species, lipogenesis takes place primarily in the liver(Leveille et al.,1975).Soy-lecithin can improve the relative weight of liver and maybe correlated with the enhanced lipid metabolism in liver.3.2.Serum parametersConcentrations of plasma lipids and lipoproteins are indicative of the metabolic regulations in a steady state and,especially,of the basal adjustment of fatty acid circulation between the adipose tissue and the liver (Amal et al.,2002).Several studies have indicated that lecithin,a phosphatidyl choline containing phospholi-pid,has hypocholesterolemic properties(Thomas et al., 1998).Effects of soy-lecithin on serum concentrations of lipoproteins for all broilers after42days are shown in Fig.1.In SL3group,feeding soy-lecithin resulted in a lower serum concentration of TC(P=0.079)and LDL-C(P=0.071),and it is in agreement with previous works (Jones et al.,1992;Thomas et al.,1998;Tompkins and Parkin,1980),whereas serum concentrations of HDL-C and TG were increased.It is not clear through which mechanism soy-lecithin induces its plasma cholesterol-lowering effects.Possibly,this might be brought about by inhibiting the absorption of cholesterol in the small intestine as suggested by Iwata et al.(1992)and Spilburg et al.(2003).In the present study,the circulating levels of TSH and INS were increased when crude soybean lecithin was included in the diets of broilers in a proportion of2% (Table4).No significant differences were observed on the serum SG,FFA and T4except that the concentration of T3in SL1group was decreased compared with other groups(P b0.05).Key plasma metabolic hormones (insulin,glucagon and T3)are important factors that determine the level of hepatic lipogenesis in birds (Hillgartner et al.,1995).3.3.Hepatic lipogenic gene expressionSoybean lecithin affected the expression of hepatic genes involved in lipid metabolism,particularly those genes regulating lipogenesis including acetyl-CoA car-boxylase(ACC),malic enzyme(ME),fatty acid synthase (FAS)and stearoyl-CoA(Δ9)desaturase1(SCD1) (P b0.05)(Fig.2).In the present study,soybean lecithin caused the increases of ME,FAS,ACC and SCD1mRNA levels in a dose-dependent manner(Table5).In addition, expression of liver fatty acid binding protein(L-FABP), which is involved in lipid transport,and the transcriptionTable5Correlations between diet soybean lecithin levels and the expression of genes related to lipogenesis in broiler chickens aVariable b Lecithin ME FAS ACC SCD1SREBP-1FABP Lecithin1ME0.702(0.002)1FAS0.6330.807(0.002)(0.000)1ACC0.6360.7440.890(0.002)(0.001)(0.000)1SCD10.6290.5440.4420.708(0.002)(0.029)(0.058)(0.001)1SREBP-10.5660.7050.5790.7110.609(0.005)(0.002)(0.007)(0.000)(0.003)1FABP0.5000.2500.4750.2750.3190.357(0.015)(0.351)(0.034)(0.241)(0.170)(0.103)1a Pearson's correlation coefficients(r)shown with P values in parentheses.b ACC=acetyl-CoA carboxylase;FAS=fatty acid synthase;ME=malic enzyme;SREBP-1=sterol regulatory element binding protein-1;SCD1= stearoyl-CoA(Δ9)desaturase1.L-FABP=fatty acid binding protein(liver).58J.Huang et al./Livestock Science118(2008)53–60factor sterol regulatory element binding protein-1 (SREBP-1)were influenced in a similar manner.In general,lipogenic gene expression levels relative toβ-actin were increased significantly with inclusion of lecithin in the diets(P b0.05).Some of the highest correlations were found among lipogenic genes linked in the lipogenisis such as ME,FAS,ACC and SREBP-1. This undoubtedly reflects the role of this key transcription factor in coordinating hepatic lipogenesis.The expression of a number of lipogenic enzyme genes such as FAS,ME, ACC,SCD1is directly influenced by SREBP-1(Richards et al.,2003).In the present study,the expression of SREBP-1was closely correlated with the expression of FAS genes,and this is consistent with Gondret et al. (2007)who observed that the relative distribution of ADD-1/SREBP-1mRNA between adipose tissue and liver closely parallels that of FAS expression in various species including rodents(rabbit),monogastric mammals (pig),and birds(chicken).In birds,the accumulation of lipid in extra hepatic tissues results to a large extent from the combined effects of hepatic lipogenesis and lipopro-tein production.Therefore,plasma triglyceride levels are dependent on the level of hepatic lipogenesis.In the present experiment,soybean lecithin increased serum levels of INS and TSH and up-regulated the expression of lipogenic genes(P b0.05).Nutritional(energy)status and the subsequent responses of key plasma metabolic hormones(insulin, glucagon and T3)are important factors that determine the level of hepatic lipogenesis in birds.Hepatic lipogenesis is highly responsive to changes in the diet(Hillgartner et al., 1995).In the present study,the food consumption of broilers fed with2%soybean lecithin was lower than other groups as was observed by our previous work (Huang et al.,2007)and(Azman and Ciftci,2004).Gene expression may be regulated anywhere from transcription to the actual enzyme protein.Soybean lecithin is a well known emulsifier to promote the apparent digestibility of dietary fat in diets fed to chicks(Polin,1980b).The up-regulated expression of lipogenic genes may be related to the increased lipid metabolism in the live of broilers.In conclusion,soybean lecithin alters serum lipids profiles and some key metabolic hormones and hepatic lipogenic gene expressions in broilers.The results im-plied that soy-lecithin could regulate fat metabolism of broilers by altering the hormone levels and lipogenic gene expressions in broiler chickens.AcknowledgementsThis work was supported by the National Basic Research Program of China,Project No.2004CB117500.The authors are grateful to Pro.R.Q.Zhao,associate Pro.Y.M.Zhou.Thanks are also extended to L.N.Wang, S.Wei,Y.Hu,H.T.Fan for their kind help.ReferencesAmal,M.,Michel,L.,Solang,G.,Maryline,K.,2002.Effect of dietary fats on hepatic lipid metabolism in the growing p.Biochem.Physiol.,Part B132,473–483.Azman,M.A.,Ciftci,M.,2004.Effects of replacing dietary fat with lecithin on broiler chicken zootechnical performance.Revue Med.Vet.155,445–448.Blanch,A.,Barroeta,A.,Baucells,M.,1996.Utilization of different fats and oils by adult chickens as a source of energy,lipid and fatty acids.Anim.Feed Sci.Tech.61,335–342.Duran-Montg,P.,Lizardo,R.,Torrallardona,D.,Esteve-Garcia,E., 2007.Fat and fatty acid digestibility of different fat sources in growing pigs.Livest.Sci.109,66–69.Folch,J.,Lees,M.,Sloane,G.H.,1956.A simple method for the isolation and purification of total lipides from aninal tissues.Biol.Chem.226,497–509.Gondret,F.,Ferre,P.,Dugail,I.,2007.ADD-1/SREBP-1is a major determinant of tissue differential lipogenic capacity in mammalian and avian species.Lipid Res.42,106–113.Harry,D.G.,Kunda,G.,Dawn,W.,Simon,C.,1992.Adipose tissue lipogenesis and fat deposition in leaner broiler chickens.Nutr.122, 363–368.Hillgartner,F.,Salati,L.,Goodridge,A.,1995.Physiological and molecular mechanisms involved in nutritional regulation of fatty acid synthesis.Physiol.Rev.75,47–76.Iwata,T.,Hoshi,S.,Takehisa,F.,Tsutsumi,K.,Furukawa,Y.,Kimura, S.,1992.The effect of dietary safflower phospholipid and soybean phospholipid on plasma and liver lipids in rats fed a hypercho-lesterolemic diet.J.Nutr.Sci.Vitaminol(Tokyo)38(5),471–479. Jenkins,T.C.,Gimenez,T.,Cross, D.L.,1989.Influence of phospholipids on ruminal fermentation in vitro and on nutrient digestion and serum lipids in sheep.J.Anim.Sci.67,529–537. Huang,J.,Yang,D.,Wang,T.,2007.Effects of replacing soy-oil with soy-lecithin on growth performance,nutrient utilization and serum parameters of broilers fed corn-based n-Aust J.Anim.Sci.12,1880–1886.Jones,D.B.,Hancock,J.D.,Harmon,D.L.,Walker,C.E.,1992.Effects of exogenous emulsifiers and fat sources on nutrient digestibility, serum lipids,and growth performance in weanling pigs.J.Anim.Sci.70,3473–3482.Krogdahl,A.,Sell,J.L.,1989.Influence of age on lipase,amylase,and protease activities in pancreatic tissue and intestinal contents of young turkeys.Poult.Sci.68,1561–1568.Kussaibati,R.,Guillaume,J.,Leclercq,B.,1982.The effects of age, dietary fat and bile salts,and feeding rate on apparent and true metabolisable energy values in chickens.Br.Poult.Sci.23,393–403. Lechowski,R.,Bielecki,W.,Sawosz,E.,Krawiec,M.,Klucinski,W., 1999.The effect of lecithin supplementation on the biochemical profile and morphological changes in the liver of rats fed different animal mun.23,1–14.Leveille,G.A.,Romsos,D.R.,Yeh,Y.,O'Hea,E.K.,1975.Lipid biosynthesis in the chick.A consideration of site of synthesis, influence of diet and possible regulatory mechanisms.Poult.Sci.54,1075–1093.NRC,1994.Nutrient Requirements of Poultry.National Academy Press,Washington,A.59J.Huang et al./Livestock Science118(2008)53–60Polin,D.,Wing,T.,Ki,P.,Pell,K.E.,1980a.The effect of bile acids and lipase on absorption of tallow in young chicks.Poult.Sci.59, 2738–2743.Polin,D.,1980b.Increased absorption of tallow with lecithin.Poult.Sci.59,1652.Richards,M.P.,Poch,S.M.,Craig,N.C.,Rosebrough,R.W.,2003.Feed restriction significantly alters lipogenic gene expression in broiler breeder chickens.Nutr.133,707–715.Ristic,M.D.,Ristic,V.,Tepsic,V.,2003.Effect of soybean Leci-Vita product on serum lipids and fatty acid composition in patients with elevated serum cholesterol and triglyceride levels.Nutr.Res.23, 465–477.Wang,R.,Li,D.,Yang,W.,Gao,Y.,1999.Effects of soybean lecithin on broiler performance.Feed Indus.20,8–10.Spilburg,C.A.,Goldberg,A.C.,McGill,J.B.,Stenson,W.F.,Racette, S.B.,Bateman,J.,McPherson,T.B.,Ostlund,R.E.,2003.Fat-freefoods supplemented with soy stanol–lecithin powder reduce cholesterol absorption and LDL cholesterol.Am.Diet Assoc.103,577–581.Theil,P.K.,Lauridsen,C.,2007.Interactions between dietary fatty acids and hepatic gene expression in livers of pigs during the weaning period.Livest.Sci.108,26–29.Thomas,A.W.,Craig,M.M.,Robert,J.N.,1998.Soy lecithin reduces plasma lipoprotein cholesterol and early atherogenesis in hypercho-lesterolemic monkeys and hamsters:beyond linoleate.Atherosclerosis 140,147–153.Tompkins,R.K.,Parkin,L.G.,1980.Effects of long-term ingestion of soya phospholipids on serum lipids in humans.Am J.Surg.140, 360–364.60J.Huang et al./Livestock Science118(2008)53–60。