Cloning of Ten Peroxidase (POD) Genes from Tamarix

Cloning of Ten Peroxidase (POD )Genes from Tamarix Hispida and Characterization of their Responses to Abiotic StressCaiqiu Gao &Yucheng Wang &Guifeng Liu &Chao Wang &Jing Jiang &Chuanping YangPublished online:5August 2009#Springer-Verlag 2009Abstract Plant peroxidases (PODs)have been ascribed a variety of biological functions,including hydrogen perox-ide detoxification,lignin biosynthesis,hormonal signaling,and stress response.In the present study,ten POD genes,including three ascorbate peroxidases (class I POD s)and seven secretory peroxidases (class III POD s),were cloned from Tamarix hispida.The roles of the ten POD genes were addressed under different abiotic stress conditions,and gene expression profiles in roots,stems,and leaves were evaluated using real-time quantitative reverse-transcribed polymerase chain reaction.Our results showed that the relative abundance of the POD s was markedly different in roots,stems,and leaves,indicating that POD activity differs in these three organs.ThPOD1and ThPOD8were the most and least abundant,respectively,in all organs.The expression profiles in response to abiotic stresses were organ specific.All of the genes were highly induced by drought,salt,salt –alkaline,CdCl 2,and abscisic acid (ABA)treatments in at least one organ.Five ThPOD genes were induced in roots,stems,and leaves under all of the studied stress conditions,indicating that they are closely associated with abiotic stress.Our results demonstrate that the ten plant peroxidases are all expressed in leaves,stems,and roots,that they are involved in different abiotic stress responses,and that they are controlled by an ABA-dependent stress signaling pathway.Keywords Abiotic stress .Gene cloning .Gene expression .Peroxidase .Tamarix hispidaIntroductionPlant exposure to environmental abiotic stress conditions such as salt,drought,cold,herbicides,and heavy metal pollutants can lead to an excess accumulation of reactive oxygen species (ROS)in cells.This buildup of ROS results in toxicity,which can nonspecifically damage many cellular components,including membranes,nucleic acids,proteins,and photosynthetic anisms have evolved to counteract the effects of ROS with antioxidants and antioxidative enzymes that maintain ROS balance within the cell.Of the antioxidative enzymes,peroxidases (POD)play key roles in cellular ROS detoxification.Almost every organism contains PODs (Passardi et al.2004).Due to the important roles of PODs in stress responses,research has focused on enzymatic activity and POD gene expression in higher plants subjected to environmental stresses such as cold,water deficit,NaCl,heavy metals,and pathogen invasion (Azevedo Neto et al.2006;Sharma and Dubey 2004;Xu et al.2008).However,previous studies have mainly focused on POD genes from grass species;little research has investigated POD genes in woody plants and particularly woody halophytes.Since there are many differences between woody and grass plants,such as structure,growth,and development,physiological differ-ences between them in response to abiotic stresses may exist.Therefore,gene cloning and analysis of woody plants may provide greater insights into abiotic and biotic stress tolerance.Tamarix hispida (tamarisk)is a shrub or small tree exhibiting tolerance to various stresses,including salt,C.Gao :Y .Wang :G.Liu :C.Wang :J.Jiang :C.Yang (*)Key Laboratory of Forest Tree Genetic Improvement and Biotechnology,Northeast Forestry University,Ministry of Education,26Hexing Road,150040Harbin,People ’s Republic of China e-mail:yangchuanpingnefu@Plant Mol Biol Rep (2010)28:77–89DOI 10.1007/s11105-009-0129-9drought,and high temperatures.In the present study,ten ThPOD genes,including three ascorbate peroxidases(class I PODs)and seven secretory peroxidases(class III PODs), were identified in T.hispida.To better understand the possible roles of ThPODs in defense against abiotic stress, a time course expression analysis of each of the ten ThPOD genes was performed.We studied POD expression in response to drought,salt,salt–alkaline,CdCl2,and abscisic acid(ABA)treatments in roots,stems,and leaves of T. hispida.Our results may help to elucidate the roles of different POD s in abiotic stress responses.Materials and MethodsPlant Materials and TreatmentsT.hispida seeds were sown in pots containing a mixture of turf peat and sand(2:1v/v)under controlled greenhouse conditions of70–75%relative humidity, 14-h light,and an average temperature of24°C.Two-month-old well-watered T.hispida seedlings were used for different abiotic stress treatments.The seedlings were well watered at the roots with one of the following solutions:0.4M NaCl,0.3M NaHCO3,20%(w/v) polyethylene glycol(PEG)6000,100μM ABA,or 150μM CdCl2for0,6,12,24,48,and72h.During the treatment period,the seedlings were watered at the roots with their treatment solution every day.Following these treatments,leaves,stems,or roots from at least24 seedlings were harvested.The harvested leaves,stems,or roots from each seedling were pooled,immediately frozen in liquid nitrogen,and stored at−80°C until RNA preparation.Three samples from each treatment were prepared for real-time polymerase chain reaction(PCR) biological repeats.POD EST Clone IdentificationSix cDNA libraries were constructed,including three libraries from T.hispida leaves treated with0.4M NaHCO3 solution for0,24,and52h(Gao et al.2008)and three from T.hispida roots treated with0.4M NaCl solution for0,24, and48h(Li et al.2009).The clones from different libraries were randomly picked for sequencing.In total, 17,173expressed sequence tags(ESTs)were obtained from the six libraries.The CAP3assembly program was used to assemble ESTs into singletons and contigs(40-bp overlap,95%identity).The functional annotation of ESTs was performed using BLASTX and BLASTN analyses. The ESTs representing the different POD genes were identified from the T.hispida cDNA libraries according to their functional annotations.Then,the library clones containing the PODs were further sequenced to confirm their sequences.Sequence Alignments and Phylogenetic AnalysisIn total,ten unique POD genes from30putative ThPOD ESTs were obtained,designated ThPOD1–ThPOD10. Among these,five were represented by full-length cDNAs. These ten ThPOD s were assigned GenBank accession numbers(FJ617194–FJ617203).All ThPOD protein sequences were aligned using ClustalX and subsequently adjusted manually.Molecular weight(MW)and isoelectric point(pI)predictions for every deduced ThPOD were carried out with the Compute pI/MW tool(http://www. /tools/protparam.html).Signal peptide predic-tions for the five full-length ThPOD proteins were completed using the Signal peptide tool(http://www.cbs. dtu.dk/services/SignalP/).The deduced amino acid sequen-ces from the ten ThPOD cDNAs were subjected to phylogenetic analysis by conducting a phylogenetic tree reconstruction in ClustalX.Sample Preparation for Real-time Quantitative RT-PCRTotal RNA was isolated from some of the collected leaves,roots,and stems using Trizol(Invitrogen,USA). Total RNA was digested with DNase I(Promega)to remove any residual DNA.Approximately0.5μg of total RNA was reverse-transcribed(RT)to cDNA using a 10-μl volume of an oligodeoxythymidine primer follow-ing the PrimeScript™RT reagent Kit(TaKaRa)protocol. The synthesized cDNAs were diluted to100μl with sterile water and used as the template for real-time PCR.Real-time Quantitative RT-PCRReal-time RT-PCR was carried out in an Opticon TM2 machine(Bio-Rad,Hercules,CA,USA)using a real-time PCR MIX Kit(SYBR Green as the fluorescent dye, TOKOBO).Primers chosen for real-time RT-PCR are given in Table1.The alpha tubulin(FJ618518),beta tubulin (FJ618519),and actin(FJ618517)genes were used as internal controls(reference genes)to normalize the total RNA amount present in each reaction.The reaction mixture (20μl)contained10μl of SYBR Green Real-time PCR Master Mix(Toyobo),0.5μM of each forward and reverse primer,and2μl of cDNA template(equivalent to100ng of total RNA).The amplification was completed using the following cycling parameters:94°C for30s followed by45 cycles at94°C for12s,60°C for30s,72°C for40s,and 1s at78.5°C for plate reading.A melting curve was generated for each sample at the end of each run to assess amplified product purity.Three independent experiments(biological replicates)of the real-time PCR were carried out to ensure the reproducibility of results.Clone expression levels were calculated from the threshold cycle according to 2−ΔΔCt (Livak and Schmittgen 2001).The expression patterns of ThPOD genes were clustered under various stress time points for each treatment using Cluster 3.0.The calculation settings were as follows:the data were adjusted with log transformation;similarity was measured by standard correlation,and the clustering method used the average linkage.Data were analyzed using the SPSS software package (SPSS,Chicago,IL,USA).ResultsCharacterization of ThPODsIn total,30ESTs encoding ThPODs were identified from the six T.hispida cDNA libraries.The ESTs represented ten unique POD s.Among them,five unique POD s exhibited complete open reading frames (ORFs),and the ORFs encoded deduced polypeptides of 250–361amino acids,with a predicted molecular mass of 27.6–39.3kDa and pI of 5.3–8.27(Table 2).BLASTP characterized the ten POD genes as three ascorbate peroxidases and seven secretory peroxidases.Four of the secretory peroxidases with full ORFs contained a 19–29-amino-acid signal peptide (Fig.1).Phylogenetic reconstruction of the ten ThPODs based on amino acid sequence alignments was performed (Fig.2).The ThPODs were generally divided into two distinct groups based on observed genetic distances.Group I included ThPODs 1,9,and 10,identified as class I peroxidases.The other ThPODs comprised group II,which were class III peroxidases.The distribution of the 30ESTs in the six cDNA libraries is shown in Table 3.It is interesting that the number ofESTs representing different ThPODs increased twofold after 52h of NaHCO 3stress and threefold at 24h of NaCl stress,indicating that ThPOD activity may be enhanced by NaCl and NaHCO 3stresses.Relative Expression Levels of ThPOD Family Genes in Different T.Hispida TissuesThe relative abundance of the ten ThPOD genes in different plant organs (roots,stems,and leaves)under normal growing conditions was analyzed using real-time RT-PCR data.The genes with the lowest expression levels (the highest delta Ct value)were assigned as one,and the expression level of the other ThPOD genes was plotted relative to the normalized expression (Fig.3).The relative abundance of the ten ThPODs exhibited marked differences in roots,stems,and leaves.Generally,ThPOD1was the most abundant gene in roots,stems,and leaves,and ThPOD6followed ThPOD1,while the ThPOD8was the least abundant in roots,stems,and leaves.The abundance of ThPOD1was 11,014,5,300,and 7,361times greater than the lowest abundance values (ThPOD8)in root,stem,and leaf tissue,respectively.ThPOD Gene Expression Profiles under Abiotic Stresses and Exogenous ABA Treatments ABA ApplicationAll ThPODs (with the exception of ThPOD2)shared similar root expression patterns and were clearly upregu-lated (greater than twofold)during at least one treatment time.The genes were slightly differentially expressed in the early stages of treatment (6h),and all genes (exclusive of ThPOD2and ThPOD6)reached a maximum expression level at 12h of stress.ThPOD3exhibited the highest induction and was upregulated 7.5-to 111.6-fold during theGene Forward primers (5′–3′)Reverse primers (5′-3′)ThPOD1GTGCTCCTCTTATGCTTCGGTCCTCCAGTAACTTCAACA ThPOD2TGTGGATAACAAGTTCCGTCAG AGGGCATTGAGCTTCTACTG ThPOD3ATGGCCTTCAAGATCATCAGC AAGCAGTCGTGGAAATGAAGG ThPOD4CACCACCAGAAGAACAAATCG CCCTAATGAAACAGTCATGG ThPOD5CGTTGTGGTATGCCTCGTCGAAGTTGGCAGTGTCGTCTA ThPOD6ACTGGAAGAAGAGATGGAAGG GCATTTCTTGAGCATGTGTGG ThPOD7ACCCGAGACTGCTGAAGG CATAGACTCCGCAAACGCThPOD8CGTCTCTTCTTTCACGATTGC TAGAGGAACGGGAAAATAAGG ThPOD9ACTGGGGAGGGCACATCC GTCCCTGAAGAAAGCATCC ThPOD10CAAAGAAAGAAGGGATGA GTGCCAGAAGTAGGTGATT Actin AAACAATGGCTGATGCTG ACAATACCGTGCTCAATAGG α-tubulin CACCCACCGTTGTTCCAG ACCGTCGTCATCTTCACC β-tubulinGGAAGCCATAGAAAGACCCAACAAATGTGGGATGCTTable 1Primers used for quan-titative RT-PCR analysisstudy period.In contrast,ThPOD2expression in roots was downregulated,and the expression level at6h of stress decreased90%compared with0h.In stems,with the exception of ThPOD2,all ThPOD genes maintained upregulation during the ABA treatment period.Seven ThPOD genes reached their lowest expression level at 12h of stress.In leaves,all of the genes were induced (greater than twofold),and most reached their lowest expression level at48h.Consistent with root and stem tissue,ThPOD3was also highly induced in leaves,with an induction level from18-to114-fold(Fig.4).NaCl StressAll ThPOD genes in roots were highly upregulated(greater than fourfold)during the NaCl stress period,except at48h. The most highly induced gene was ThPOD3,exhibiting a 911-fold induction level at6h of stress.All ThPOD genes were upregulated after NaCl stress in stems,with the exception of ThPOD2and ThPOD6.ThPOD2was transiently upregulated from12to48h.ThPOD6expres-sion markedly changed and was downregulated at6,24, and72h of stress but upregulated at12and48h.In leaves, the expression of all ThPOD genes was divided into two distinct groups.One group was composed of ThPOD1,2,3, and6and was clearly downregulated.ThPOD2maintained downregulation at all stress times.The second ThPOD group(with the exception of ThPOD7)was upregulated during the NaCl treatment period(Fig.5).PEG StressIn roots,the expression patterns of ThPOD genes under PEG stress were divided into two main groups.One group contained ThPOD1,6,5,and7,which were upregulated at 6h of stress and downregulated at other time points.The other group was upregulated after PEG stress.The most highly induced gene in roots was ThPOD8,with an induction of15.6-fold at24h of treatment.Seven ThPOD genes were upregulated more than twofold in stems; however,this upregulation was not observed in ThPOD2, ThPOD5,or ThPOD6.ThPOD2and ThPOD6were highly downregulated in stems by PEG stress.All of the genes were differentially regulated in leaves(greater than two-fold)at least once during the stress period.However, ThPOD6maintained downregulation during PEG treat-ment,while all other genes exhibited a greater than twofold upregulation.All ThPOD genes(except ThPOD8)reached an expression peak at24or48h of stress in leaves.The most highly induced gene was ThPOD3,which was induced37-fold at24h in leaf tissue(Fig.6).NaHCO3StressAll ThPOD genes,except for ThPOD6and ThPOD7,were upregulated in roots for at least four time points in the treatment period.The most highly induced gene was ThPOD3,with a128-fold induction at6h during NaHCO3 treatment.All genes(excepting ThPOD7)showed upregu-lation by more than twofold at6and72h of stress in roots, indicating a marked response to NaHCO3stress.In stems, all ThPOD genes showed upregulation at12,24,and72h. In addition,all genes reached their highest expression level at24h of stress treatment.All genes reached their expression peaks in leaves(greater than fivefold induction) at12h of stress.The most highly induced gene was ThPOD9with27.9-fold induction(Fig.7).CdCl2StressThPOD genes exhibited many different expression patterns under CdCl2stress in root tissue.ThPODs3,5,8,and9Table2Characteristics of the ten ThPODs from T.hispidaGene name GenBank accession number Annotation Deduced numberof amino acidsPI MW(Da)ThPOD1FJ617194Cytosolic ascorbate peroxidase(class I POD)250 5.7927,645.4 ThPOD2FJ617195Peroxidase(class III POD)328 5.3035,870.7 ThPOD3FJ617196Peroxidase(class III POD)361 6.5939,296.6 ThPOD4FJ617197Peroxidase(class III POD)3248.0635,833.9 ThPOD5FJ617198Class III peroxidase(class III POD)3208.2733,991.1 ThPOD6a FJ617199Cationic peroxidase(class III POD)2439.2727,815.1 ThPOD7a FJ617200Putative peroxidase(class III POD)2137.4323,800.9 ThPOD8a FJ617201Peroxidase,putative(class III POD)2938.9232,330.9 ThPOD9a FJ617202Peroxisomal ascorbate peroxidase(class I POD)149 6.1016,424.6 ThPOD10a FJ617203Thylakoid-bound ascorbate peroxidase(class I POD)356 6.2339,352.5 a Partial cDNAFig.1Multiple-sequence alignment of the ten POD proteins from T.hispida.Among these proteins,five PODs had complete ORF,and the others had partial cDNA sequences.Signal prediction analysis showed that four PODs contained signal peptides of19–29amino acids.The signalpeptide of each POD was underlined with black linewere upregulated during the stress period.All of the other genes(except ThPOD6)were downregulated at72h and upregulated at the other treatment times.In stems,ThPOD6 was downregulated,and all other genes were upregulated by more than twofold for at least two time points.In leaves, six ThPOD genes were upregulated during the CdCl2stress period.ThPOD6was generally downregulated in leaf tissue during the CdCl2treatment period.The expression patterns of ThPODs1,2,and10differed from the other genes in leaf tissue,showing significant upregulation and down-regulation during the stress period.It should be noted that ThPOD3was induced in roots, stems,and leaves during the stress period,with the lowest induction of7.9-fold in leaf tissue,and the highest induction of245-fold in stem pared with the 0-h level,the expression of ThPOD3in stems increased nearly100-fold.Furthermore,ThPOD3exhibited rapid induction by CdCl2,and the highest expression level was at6or12h of stress in roots,stems,and leaves(Fig.8). DiscussionIn a previous study,to identify genes potentially involved in stress tolerance,we constructed three cDNA libraries from roots of T.hispida and three from leaves.In the present study,we identified30EST cDNAs representing ten unique ThPOD genes from these six T.hispida cDNA libraries.The genes are members of two POD superfamilies (class I and class III).In order to evaluate the possible roles of these ThPOD genes in the defense response of T.hispida against different abiotic stresses and ABA exposure, expression analysis was carried out using real-time quan-titative RT-PCR.To assay the abundance of the ten ThPOD s in different organs,we analyzed the relative transcript levels of the genes in roots,stems,and leaves.Marked differences in the abundance of the ten ThPOD s were observed in the three organs under normal growth conditions(Fig.3).ThPOD1 and ThPOD6showed high transcript levels in root,stem, and leaf tissue,suggesting that these two genes have a greater functional role than others within the plant. ThPOD8exhibited the lowest transcriptional level in all organs,suggesting lower activity relative to the other genes. The other ThPOD genes varied in their expression levels among root,stem,and leaf tissue,indicating that these genes have roles specific to one or more of the organs.The highest protein sequence homology(53%)was observed between ThPOD1and ThPOD9.Although these two genes are predicted to be cytosolic ascorbate PODs by sequence analysis(BLASTP),their expression levels differed.ThPOD1showed the highest abundance in root, stem,and leaf tissue while the abundance of ThPOD9was only0.06-,0.03-,and0.02-fold that of ThPOD1in leaves, stems,and roots,respectively.These results suggest that, although the POD proteins share high sequence homology, the activity of their genes can be markedly different.Before focusing attention on transgenic functional analysis,it is necessary to identify which members of a gene family are responsive to abiotic stress.The genes responding to abiotic stress are more likely involved in stress responses and plant stress tolerance.Our results demonstrated that all ThPOD genes were differentially regulated by at least one abiotic stress,suggesting that all ten ThPOD genes are involved in abiotic stress responses in T.hispida.However,expression patterns varied among the genes,including different responses to stress type and time and variations in organ specificity.In roots,all ThPOD genes were highly upregulated (>4.5-fold)for at least four time points,and theyshowed Table3The distribution of POD ESTs among the T.hispida cDNA librariesGene name LibraryRoot libraries Leaf libraries0h24h48h0h24h52hThPOD1121210 ThPOD2030000 ThPOD3010000 ThPOD4100000 ThPOD5030001 ThPOD6101112 ThPOD7000001 ThPOD8000100 ThPOD9000013 ThPOD10000010 Total392447similar expression patterns,indicating that all ThPODs may be cooperatively regulated in roots under salt stress.NaCl treatment induced an increase in the expression of ThPODs in roots relative to stem and leaf tissue.Roots are important organs for carrying water and mineral nutrients to the plant.As such,roots are the primary site of recognition and injury for several types of water-limiting stresses,including salinity and drought (Jiang and Deyholos 2006).In stems or leaves,over half of the ThPOD genes maintained upregulation during the entire treatment time,suggesting that these genes play a role in salt tolerance in root,stem,and leaf tissue (Fig.5).Consistent with these results,previous studies also showed that POD genes are upregu-lated by salinity stress in plants (Menezes-Benavente et al.2004;Sreenivasulu et al.2000).NaHCO 3stress,which represents both saline and alkaline conditions,caused greater induction and expres-sion of ThPOD genes than NaCl stress.Furthermore,NaHCO 3stress was distinct from NaCl stress because it induced ThPODs more rapidly than NaCl stress.All of the genes reached their highest expression levels at 24h in stems,12h in leaves,and 6or 24h in roots.Previous studies have indicated that the first hours after the initiation of a stress factor often determine further changes in the organism.Early in the stress period,ROS are formed,and some signaling pathways are stimulated,and this may increase the stress levels and/or enhance plant resistance (Maksymiec and Krupa 2006).Since both NaCl and NaHCO 3have equal sodium stress levels,the stronger induction of ThPODs in the first hours of stress (before 24h)by NaHCO 3may be due to high pH stress and not NaCl.The strong induction of ThPODs by NaHCO 3suggests that ThPODs play important roles in ROS detoxification in cells under NaHCO 3stress.Previous studies demonstrated upregulation of POD genes in response to drought stress,and transgenic plants expressing exogenous POD genes showed high levels of tolerance to drought stress (Kim et al.2008;Koussevitzky et al.2008).In the current study,we found two different ThPOD expression patterns under PEG stress;some ThPOD genes were generally downregulated during the PEG stress period,while others were obviously upregulated during PEG stress.The difference between these expression trends suggests that the genes function independently and play specific roles in PEG stress processes.Toxic levels of heavy metals have been reported to affect a variety of processes in plants (Unyayar et al.2006;Rau et al.2007).One of the major consequences of heavy metal stress is enhanced production of ROS (Drazkiewicz et al.2004).In Arabidopsis thaliana leaves,during the first hours of exposure to excess Cu or Cd,a considerable increase in peroxidase accumulation was observed (Maksymiec and Krupa 2006).Our study showed that some ThPOD genes were highly upregulated by CdCl 2,and,in stems,all POD genes were upregulated.The increased upregulation of POD s may be a response to the accumulation of ROS generated by CdCl 2.ABA has been implicated in responses to salt,water deficit,cold,and wounding.Recent studies reported that exogenous ABA stimulated expression of the peroxidase gene (Rossel et al.2006).In our study,all of the ThPOD genes were induced in roots,stems,and leaves by exogenous ABA treatment,demonstrating that ABA-dependent molec-ular genetic pathways regulate these PODs.110100100010000100000ThPOD1ThPOD2ThPOD3ThPOD4ThPOD5ThPOD6ThPOD7ThPOD8ThPOD9ThPOD10GeneR e l a t i v e e x p r e s s i o n l e v e lrootstemleafFig.3Relative abundance of the ten ThPODs in root,stem,and leaf tissues of T.hispida.The ThPOD8genes,which had the lowest expression levels (the highest delta Ct value)in all of the tissues of root,stem,and leaf,were assigned as 1,and the expression level of other ThPOD genes was plotted relative to the expression of ThPOD8.Y -axis shows the relative expression level of ThPOD genes,and X -axis shows the ThPOD genes.The relative expression levels of different ThPODs were log10-transformed.The error bars were obtained from multiple replicates of the real-time PCRBFD EA-4-202468ThPOD1ThPOD2ThPOD3ThPOD4ThPOD5ThPOD6ThPOD7ThPOD8ThPOD9ThPOD10R e l a t i v e e x p r e s s i o n l e v e l-4-20246810ThPOD1ThPOD2ThPOD3ThPOD4ThPOD5ThPOD6ThPOD7ThPOD8ThPOD9ThPOD10R e l a t i v e e x p r e s s i o n l e v e l-4-20246810ThPOD1ThPOD2ThPOD3ThPOD4ThPOD5ThPOD6ThPOD7ThPOD8ThPOD9ThPOD10GenesR e l a t i v e e x p r e s s i o n l e v e lCABCD FE-4-2024681012ThPOD1ThPOD2ThPOD3ThPOD4ThPOD5ThPOD6ThPOD7ThPOD8ThPOD9ThPOD10GenesR e l a t i v e e x p r e s s i o n l e v el-4-20246810ThPOD1ThPOD2ThPOD3ThPOD4ThPOD5ThPOD6ThPOD7ThPOD8ThPOD9ThPOD10R e l a t i v e e x p r e s s i o n l e v e l-4-2024681012ThPOD1ThPOD2ThPOD3ThPOD4ThPOD5ThPOD6ThPOD7ThPOD8ThPOD9ThPOD10R e l a t i v e e x p r e s si o n l e v e lExpression analysis of the ten ThPODs responding to NaClstress.The relative expression level =transcription level under stress treatment/transcription level under control condition (0h).All of the relative expression levels were log2-transformed.The error bars were obtained from multiple replicates of the real-time PCR.Theexpression patterns were clustered under different stress time points using Cluster 3.0.a ,b ,c Expression of ThPODs in roots,stems,and leaves.d ,e ,f Cluster analysis of ThPOD expression in roots,stems,and leavesThe ten ThPODs were highly induced by drought,salt,salt –alkaline,CdCl 2,and ABA treatments in at least one organ,indicating that they are all associated with abiotic stress responses and involved in ABA-dependent stress responses.In particular,ThPODs 3,6,8,9,and 10were most often highly induced in roots,stems,and leaves under NaCl,NaHCO 3,PEG,CdCl 2,and ABA treatments.These results suggest that they may play important roles in abioticABCD E F-4-20246ThPOD1ThPOD2ThPOD3ThPOD4ThPOD5ThPOD6ThPOD7ThPOD8ThPOD9ThPOD10R e l a t i v e e x p r e s s i o n l e v e l-4-20246ThPOD1ThPOD2ThPOD3ThPOD4ThPOD5ThPOD6ThPOD7ThPOD8ThPOD9ThPOD10R e l a t i v e e x p r e s s i o n l e v e l-4-20246ThPOD1ThPOD2ThPOD3ThPOD4ThPOD5ThPOD6ThPOD7ThPOD8ThPOD9ThPOD10GenesR e l a t i v e e x p r e s s i o n l e v e lBCDE FA-4-202468ThPOD1ThPOD2ThPOD3ThPOD4ThPOD5ThPOD6ThPOD7ThPOD8ThPOD9ThPOD10R e l a t i v e e x p r e s s i o n l e v e l-4-202468ThPOD1ThPOD2ThPOD3ThPOD4ThPOD5ThPOD6ThPOD7ThPOD8ThPOD9ThPOD10R e l a t i v e e x p r e s s i o n l e v e l-4-202468ThPOD1ThPOD2ThPOD3ThPOD4ThPOD5ThPOD6ThPOD7ThPOD8ThPOD9ThPOD10GenesR e l a t i v e e x p r e s s i o n l e v el-10-8-6-4-20246810ThPOD1ThPOD2ThPOD3ThPOD4ThPOD5ThPOD6ThPOD7ThPOD8ThPOD9ThPOD10R e l a t i v e e x p r e s s i o n l e v e l-10-8-6-4-20246810ThPOD1ThPOD2ThPOD3ThPOD4ThPOD5ThPOD6ThPOD7ThPOD8ThPOD9ThPOD10R e l a t i v e e x p r e s s i o n l e ve l-10-8-6-4-20246810ThPOD1ThPOD2ThPOD3ThPOD4ThPOD5ThPOD6ThPOD7ThPOD8ThPOD9ThPOD10GenesR e l a t i v e e x p r e s s i o n l e v e lFig.8Expression analysis of the ten ThPODs responding to CdCl 2stress.The relative expression level =transcription level under stress treatment/transcription level under control condition (0h).All of the relative expression levels were log2-transformed.The error bars were obtained from multiple replicates of the real-time PCR.Theexpression patterns were clustered under different stress time points using Cluster 3.0.a ,b ,c Expression of ThPODs in roots,stems,and leaves.d ,e ,f Cluster analysis of ThPOD expression in roots,stems,and leaves。