Properties of an NAD+-dependent DNA ligase from the hyperthermophile

Enzyme and Microbial Technology 46 (2010) 113–117Contents lists available at ScienceDirectEnzyme and MicrobialTechnologyj o u r n a l h o m e p a g e :w w w.e l s e v i e r.c o m /l o c a t e /e mtProperties of an NAD +-dependent DNA ligase from the hyperthermophile Thermotoga maritima and its application in PCR amplification of long DNA fragmentsYilin Le a ,Jingjing Peng b ,Jianjun Pei a ,b ,Huazhong Li a ,Zuoying Duan a ,Weilan Shao a ,b ,∗a School of Biotechnology,Jiangnan University,Wuxi,Jiangsu 214122,PR ChinabCollege of Life Sciences,Nanjing Normal University,Nanjing,Jiangsu 210046,PR Chinaa r t i c l e i n f o Article history:Received 27May 2009Received in revised form 12August 2009Accepted 24August 2009Keywords:AmplificationLong DNA fragmentsThermostable DNA ligase Thermotoga maritimaa b s t r a c tThe thermostable DNA ligase of Thermotoga maritima (Tma DNA ligase)was expressed in Escherichia coli ,and purified by heat treatment followed by metal affinity chromatography.Purified Tma DNA ligase exhibited activity on DNA fragments with cohesive termini,and no activity was detected on blunt-end DNA.The ligase reaction required NAD +,and a divalent cation including Mg 2+,Mn 2+or Ca 2+.The highest activity of Tma DNA ligase occurred at 60◦C and pH 8.0when Hind III digested plasmid was used as substrate.The purified enzyme had a half-life of over 30min at 95◦C,and retained over 80%of its activity after holding a pH ranging from 7.2to 8.8for 1h at 80◦C.When the enzyme was employed in PCR cycles,Tma DNA ligase promoted the amplification of long DNA fragments from the genomic DNA of T.maritima .© 2009 Elsevier Inc. All rights reserved.1.IntroductionDNA ligase (EC 6.5.1.1and EC 6.5.1.2)catalyzes the sealing of5 -phosphateand 3 -hydroxyl termini at single-strand breaks indouble-stranded DNA.It plays an important role in DNA replication and DNA repair pathways [1,2].DNA ligases require ATP or NAD +as cofactor.According to the different cofactor,the DNA ligases have been divided into two classes:ATP-dependent ligases [3]and NAD +-dependent ligases [4].NAD +-dependent DNA ligases have two functional domains:an N-terminal cofactor binding domain and a C-terminal DNA-binding domain [4].T4DNA ligase and Escherichia coli DNA ligase are widely used as tools for DNA recombination.T4DNA ligase uses ATP as the source of energy,while E.coli DNA ligase uses NAD +as the source of energy.Under normal reaction conditions,only T4DNA ligase can ligate blunt ends.Recently,there has been increasing interest in the study of thermostable DNA ligase,which has been found useful either in DNA ligation for gene cloning,or in a technique known as LCR (lig-ase chain reaction)for detecting somatic mutations and viral or bacterial infections [5].Thermostable DNA ligases have been puri-fied or cloned from various thermophilic microorganisms,which include Thermus spp.[6,7],Sulfolobus shibatae [8],Rhodothermus marinus [9],Staphylothermus marinus [10],Aeropyrum pernix [11],∗Corresponding author at:School of Biotechnology,Jiangnan University,Wuxi,Jiangsu 214122,PR China.Tel.:+862585891836.E-mail address:shaoweilan@ (W.Shao).Aquifex pyrophilus [12],and Bacillus stearothermophilus [13].But the DNA ligase of hyperthermophilic bacterium Thermotoga spp.has not been reported previously.Thermotoga maritima is the type strain of the genus,which has an optimal growth temperature of 80◦C.The complete genome of T.maritima has been sequenced [14],and contains approximately 1928predicted genes.One of these genes encodes a putative NAD +-dependent DNA ligase,which is designated as Tma DNA ligase.In the present study,the DNA ligase gene of T.maritima was cloned,and expressed in E.coli .The recombinant Tma DNA ligase was puri-fied and characterized.In addition,the application of Tma DNA ligase was explored,and the enzyme exhibited a function in pro-moting long DNA amplification in PCR.2.Materials and methods2.1.Bacterial strains and growth mediaT.maritima (ATCC43589)was grown anaerobically at 80◦C in a medium as described previously [15].E.coli strain JM109(Promega Corp.,Madison,WI,USA)was employed as the host for cloning the ligase gene from T.maritima ,and strain BL21(DE3)was used as host for gene expression.Recombinant cells were cultured in Luria-Bertani (LB)medium supplemented with 100␮g ampicillin ml −1.2.2.Cloning of the DNA ligase gene from T.maritimaThe genomic DNA isolation and molecular cloning were carried out following the methods described by Frederick et al.[16].DNA transformation was performed by electroporation.Plasmid DNA and PCR products were purified using the Qiagen Plasmid kit and PCR purification kit (Qiagen,USA).0141-0229/$–see front matter © 2009 Elsevier Inc. All rights reserved.doi:10.1016/j.enzmictec.2009.08.015114Y.Le et al./Enzyme and Microbial Technology46 (2010) 113–117On the basis of the DNA sequence(GenBank:NC000853),Tma DNA ligase gene was amplified by using the primers with Nde I and HindШrestriction sites(indicated in bold):5’-CTT CATATG AGTGAGAGAAA GATC-3’and5’-ACA AAGCTT ACTC CATTCCT TCCAAC-3 .Thirty cycles of PCR with Pyrobest DNA polymerase(TaKaRa,P.R.China) was carried out in a50␮l reaction.Each cycle consisted of heating at94◦C for40s, 51◦C for40s and72◦C for2min10s.The PCR products were purified,digested with Nde I and HindШ,and then isolated on an agarose gel.The double-digested PCR products were ligated to Nde I/HindШ-digested pET-20b(+)(Novagen,Darmstadt, Germany),and the ligation mixture was transformed into JM109.The recombinant plasmid was isolated and confirmed by DNA sequencing using an ABI Prism377 automated DNA sequencer.2.3.Expression and purification of Tma DNA ligaseE.coli BL21(DE3)cells were transformed with the recombinant plasmid,and induced to express Tma DNA ligase by adding isopropyl-␤-d-thiogalactopyranoside (IPTG)to afinal concentration of1mM at OD600about0.8.The cells were harvested by centrifugation(6000×g for10min at4◦C),and washed once with deionized water,re-suspended in a small volume of20mM Tris–HCl buffer(pH7.9)con-taining5mM imidazole and0.5M NaCl,cell disruption was carried out by French press(11,000psi,twice).Cellular debris was removed by centrifugation(20,000×g, 30min,4◦C).A heat treatment was performed by heating the suspension at80◦C for30min,then cooled in an ice bath,and centrifuged for30min at20,000×g, 4◦C.The supernatant was loaded on to an immobilized metal affinity column (Novagen,Inc),and eluted with1M imidazole and0.5M NaCl in20mM Tris–HCl buffer(pH7.9).The pooled fractions were dialyzed into storage buffer containing 50mM Tris–HCl(pH8.0),1mM EDTA,and20%(v/v)glycerol before the enzyme was stored at−20◦C.The protein concentration was determined by Bradford assay.The SDS-PAGE of the purified enzyme was performed according to standard procedures.2.4.Analysis of enzyme activity of Tma DNA ligaseThe assay for the ligating activity of Tma DNA ligase was performed by the method established by Takahashi et al.[6].The plasmid pHsh[17]was digested with Hind III(New England Biolabs)to generate a cohesive-ended DNA as ligation sub-strates.The reaction mixture contained0.1␮g Tma DNA ligase,1mM NAD+,3mM Mn2+,and150ng substrates in20␮l of50mM Tris–HCl(pH8.0).Ligation reaction was performed for1h at60◦C or as otherwise indicated.The ligation products were electrophoresed on1.0%agarose gel and the proportion of ligation products was esti-mated quantitatively from the intensity of the bands using the BandScan software (Glyko,Novato,USA).2.5.Amplification of DNA fragments in the presence of Tma DNA ligaseOn the basis of the DNA sequence(GenBank:AE001800)of T.maritima,PCR amplification was carried out using the following primers:T-1,pTACTGATGAC AAAACCGGGAAC;T-2,pGATTACTCTAAAAACACCCGTCG;T-3,pTCTCTTGTCAGCT-TAGTTTC TC;T-4,pATACTCCATCGTGTTGTTTCTG;T-5,pCTGGCACATTTGATACCT-GAAG;T-6,pGAAACGAAGGTCTTTCCTCATC(Fig.5).PCR amplification of25cycles was carried out in a20␮l reaction system containing the genomic DNA of T.maritima, 0.5U of Ex Taq DNA polymerase(TaKaRa,P.R.China),0.1␮g Tma DNA ligase,0.2mM primers,0.2mM each deoxynucleotide triphosphate,2.0mM MgCl2,and1.0mM NAD+.Cycling parameters:initial denaturation95◦C5min,subsequent steps94◦C 45s,annealing at56◦C45s,extension72◦C3min40s,additional ligation60◦C 6min.2.6.Examination of the internal sequences ligated by Tma DNA ligaseThe DNA sequences around ligated nicks in PCR products were subcloned and sequenced by using primer L1(TGCTGGGAGCCTATTATGTTC),L2(CCCAAGCT-TAATCGAGCATATTCACCTG),and primer L3(TGTTCCTGAA GATGTGGTGAAC),L4 (CCCAAGCTTCGGATAGATTTCCACGAAC),respectively(Fig.5).The fragments to be subcloned were amplified by Pyrobest DNA polymerase,and inserted into pHsh[17]at Stu I/HindШsites.Recombinant plasmids were sequenced,and sequence identities were analyzed by using an ABI Prism377automated DNA sequencer.2.7.The far-UV circular dichroism(CD)measurementsCD spectrum was acquired on a0.1cm path length cell of a Jasco-715spec-trometer(Jasco,Tokyo,Japan)equipped with RTE bath/circulator(NESLAB RTE-111; NESLAB,Tokyo,Japan).After a30min N2purge,the spectra was recorded from 190nm to250nm with a resolution of0.2nm,100nm min−1speed,1.0nm band-width at selected temperatures after balanced for about15min at each temperature. Protein concentration was0.105mg ml−1in H2O.The secondary structure parame-ters of Tma DNA ligase were estimated with the Jasco secondary structure manager software using the CD data-Yang.jwr as Ref.[18].3.Results3.1.Expression and purification of Tma DNA ligaseThe gene encoding the thermostable DNA ligase was ampli-fied from the genomic DNA of T.maritima,and inserted into gene expression vector pET-20b(+)at Nde I and HindШsites.The recom-binant plasmid was isolated and designated as pET-ligase,which was then transformed into E.coli BL21(DE3)for the production of Tma DNA ligase.Tma DNA ligase was expressed with a C-terminal His-tag.Most of the E.coli proteins were eliminated effectively after heat treatment at80◦C for30min.After a heat treatment and an affinity chromatography,the recombinant enzyme in cell-free extracts was purified to gel electrophoretic homogeneity(Fig.1). The yield of purified protein is1.23mg/l.An analysis by SDS-PAGE showed that the recombinant Tma DNA ligase had a molecular mass of about78kDa.3.2.The cofactor and divalent cation required for ligating activityPurified Tma DNA ligase exhibited activity of joining DNA frag-ments with cohesive termini.No DNA ligase activity was detected on the blunt-ended DNA when Stu I-digested plasmid was tried as substrate to be ligated.As shown in Fig.2,the activity of Tma DNA ligase required NAD+but not ATP as cofactor.The divalent cation Mg2+,Mn2+or Ca2+was also required by the enzyme.Fig.3shows the effect of the concentrations of NAD+,Mg2+,Mn2+or Ca2+on Tma DNA ligating activity.The optimal activity of the ligase was shown at about1mM NAD+and3mM Mn2+.However,although the enzyme also exhibited significant activity at3mM of Mg2+or Ca2+(Fig.2B),the highest ligating activity was detected when the concentration of Mg2+or Ca2+was about20mM(Fig.3B,D).3.3.Effects of pH and temperature on enzyme activity andstabilityWhen Hin d III-cleaved pHsh was used as substrate,the opti-mal ligase reaction of Tma DNA ligase occurred at60◦C,pH8.0 (Fig.4A,B).The purified enzyme retained over80%of its activity after holding a pH ranging from7.2to8.8for1h at80◦C(Fig.4C). The thermostability was evaluated by determination of the resid-ual ligating activity after incubating the mixtures(0.2mg ml−1TmaFig.1.SDS-PAGE analysis of the expression and purification of Tma DNA ligase. Lanes:M,protein marker;(1)soluble proteins of E.coli BL21(DE3)containing pET-20b(+);(2)recombinant Tma DNA ligase in soluble proteins of E.coli BL21(DE3);(3)soluble proteins after a heat treatment at80◦C for30min;(4)Tma DNA ligase purified after a His-tagged affinity chromatography.Y.Le et al./Enzyme and Microbial Technology46 (2010) 113–117115Fig.2.Requirement of cofactor and cation for the ligating activity of Tma DNA ligase.Activity assay was conducted by using Hind III-cleaved pHsh plasmid as substrate at 60◦C for1h,pH8.0.The20␮l reaction mixture contained0.1␮g Tm DNA ligase,0.15␮g substrate,1mM cofactor,and3mM cation.(A)Ligation reactions of Tma DNA ligasein the absence(Lane C)or presence of ATP,NAD+.(B)Ligation reactions of Tm DNA ligase in the absence(Lane C)or presence of variouscations.Fig.3.The effects of NAD+and cation concentrations on the ligating activity of Tma DNA ligase.The ligating activity assay was performed under standard conditions except the variation of the concentration of NAD+(A),Ca2+(B),Mn2+(C),or Mg2+(D). The ligation products were electrophoresed on1.0%agarose gel and the proportion of ligation products was estimated quantitatively from the intensity of the bands using the BandScan software(Glyko,Novato,USA).DNA ligase,50mM Tris–HCl pH8.0)for various durations at80◦C, 85◦C,90◦C,95◦C.Fig.4D shows the residual activity assayed under standard reaction conditions.After incubated at80◦C,Tma DNA lig-ase did not lose any activity,implying that no irreversible unfolding of the protein occurred during the period.The enzyme had a half-life of approximately30min at95◦C,indicating that the enzyme could stand for the temperature cycles of PCR.The conformational change was observed by far-UV circular dichroism spectra of a sample of Tma DNA ligase,which were examined in stepwise at25◦C,60◦C,80◦C,95◦C,and2nd60◦C. The relative contents of secondary structure for the ligase were obtained from the CD measurements(Table1).Provided that the enzyme was in steady state at25◦C,the variation of contents of sec-ondary structure at80◦C and95◦C could represent the tendency ofTable1Secondary structure content of Tma DNA ligase estimated from the far-ultraviolet CD spectra.Fraction of structures Temperature25◦C60◦C80◦C95◦C2nd60◦C ␣-Helix0.30.420.20.180.27␤-Sheet0.210.060.290.240.07Turn0.190.130.210.250.29 Random-coil0.30.390.30.330.37reversible and irreversible unfolding of the protein.However,the variation of contents of secondary structure at60◦C was obviously opposite to the tendency of unfolding(Table1).The most signifi-cant feature of the conformation at60◦C is a very high content of ␣-helix associated with a very low content of␤-sheet.The mea-surement at2nd60◦C proved the reversible unfolding and partial inactivation observed at80◦C and95◦C,and confirmed the confor-mation observed at60◦C following25◦C.This conformation can be related to the temperature optimum for Tma DNA ligase.3.4.Promotion of long DNA fragment amplificationWhen a couple pairs of primers are employed to amplify a long DNA fragment,the primers anneal to a template of full length,and a primer is extended at3’-end to reachthe5’-end of the next primer.Theoretically,the nicks can be repaired,and short single strand fragments can be connected before they are released from a template when the activity of DNA ligase is applied in PCR mixture(Fig.5).As the oligonucleotide primers areFig.4.The effects of temperature and pH on the ligating activity and enzyme sta-bility of Tma DNA ligase.(A)The optimal temperature determined by standard assay at various temperatures.(B)The optimal pH determined at60◦C in phthalate-imidazole buffer( ),or Tris–HCl buffer( ).(C)The pH stability of Tma DNA ligase. The remaining activity was determined after purified enzyme(0.1mg ml−1)was incubated at80◦C for1h in50mM Tris–HCl buffer.(D)The thermostability of the Tma DNA ligase.The purified enzyme(0.2mg ml−1)in50mM Tris–HCl buffer(pH 8.0)was incubated for various durations at80◦C( ),85◦C( ),90◦C( ),95◦C(•) with a paraffin oil overlay.The assay for the ligating activity of the treated lig-ase was performed under standard conditions.The activity of the enzyme without pre-incubation was defined as100%activity.116Y.Le et al./Enzyme and Microbial Technology46 (2010) 113–117Fig.5.Outline of the procedures for amplification of long DNA molecules in the presence of Tma DNA ligase.(A)Design of the primers over a 10.2kb region of chromosome DNA of Thermotoga maritima .(B)Proposed procedures for PCR amplification in the absence of DNA ligase.(C)Proposed procedures for PCR amplification in the presence of DNA ligase.complementary to the targeted sequence,there are no base mis-matches at the junction,which in favor of the ligation of nicks,and connecting each pair of fragment together to form continuous strands.To demonstrate the function of Tma DNA ligase to promote the PCR amplification of long DNA fragments,we use three pairs of primers to amplify three adjacent fragments of about 3.2kb,3.6kb and 3.4kb.In the absence of DNA ligase,the PCR prod-ucts were mainly 3.2–3.6kb fragments,and only a weak band was observed for the fragments of about 6.8–7.0kb DNA (Fig.6).However,the involvement of Tma DNA ligase in PCRprocessFig.6.Long DNA amplification promoted by the activity of Tma DNA ne M,␭EcoT14I marker;Lane 1,PCR using Ex Taq DNA polymerase;Lane 2,PCR using Ex Taq DNA polymerase and Tma DNA ligase.A PCR cycle included a repetitive series of the four steps as described in Section 2:denaturation,annealing,extension,and ligation when Tma DNA ligase was involved in PCR.significantly increased the amount of 6.8–7.0kb DNA,and the full length DNA of 10.2kb became detectable in a weak band (Fig.6).The ligation reaction can only occur at nicks before the newly polymerized fragments are released from template DNA because Tma DNA ligase could not ligate blunt-end DNA,and also because the fragments amplified by Ex Taq DNA polymerase often carry an additional A at 3 -end.This was confirmed by DNA sequence analysis.The DNA frag-ments around the ligated sites were amplified by using high fidelity DNA polymerase with primers L1,L2,and primers L3,L4(Fig.5C),and subjected to sequencing.The resulting sequence data shows that no error base was incorporated in these regions.4.DiscussionThermostable DNA ligases have been purified from various dif-ferent sources [6–13],and have been effectively applied in DNA diagnostics [5],chemical gene synthesis,and assembly of DNA frag-ments [19–21].T.maritima is a hyperthermophilic bacterium with an optimal growth temperature of 80◦C,and thus its DNA ligase is supposed to be useful in the temperature cycles of PCR.In this paper,the DNA ligase of T.maritima is for the first time to be purified and characterized,and the application of DNA ligase to promote the PCR amplification of long DNA fragments is also for the first time discussed here.By using purified Tma DNA ligase,the catalytic properties of the enzyme are investigated for designing reaction conditions.Like most bacterial origin DNA ligases,Tma DNA ligase uses NAD +as cofactor,and requires a divalent anion such as Mg 2+,Mn 2+or Ca 2+for reactions.Although Mn 2+is the best anion,3mM of Mg 2+is also effective for ligating activity (Fig.2).The ligating activity of the enzyme is higher than 90%in a pH range from pH 7.5to pH 8.5,andY.Le et al./Enzyme and Microbial Technology46 (2010) 113–117117the enzyme is relatively stable in this pH range(Fig.4B,C),which suit the pH value of the reaction mixture for PCR.Thermostabilities for the DNA ligases from thermophilic microorganisms have been determined under various conditions; T.filiformis(2h at90◦C)[7],S.shibatae(10min at90◦C)[8],R. marinus(7min at91◦C)[9],S.marinus(2.8h at100◦C)[10],and A.pernix(50min at105◦C)[11].Tma DNA ligase has a half-life of about30min at95◦C when protein concentration is0.2mg ml−1in 50mM Tris–HCl buffer,pH8.0,therefore,it is one of the most stable DNA ligases having been described to date.When Tma DNA ligase is involved in PCR,this enzyme should retain about half activity at the end of30-cycles,where the enzyme is added into the mixture after initial denaturation95◦C5min,and heated to94◦C for45s as the denaturation step for each cycle.Although Tma DNA ligase is stable up to40min at80◦C,and has a half-life of30min at95◦C,its opti-mum activity occurs at60◦C.The similar phenomenon is observed for the other thermostable DNA ligase[9–11].The far-ultraviolet CD spectra revealed that the secondary structure content of Tma DNA ligase at60◦C significantly differed from that at25◦C,80◦C, and95◦C.This result suggests that the enzyme has a unique con-formation at60◦C,which can favor the catalytic reaction for DNA ligation or nick-closing.Amplification of long DNA fragments produced by the poly-merase chain reaction has become an important tool.But long DNA amplification technique still has two limitations:thefidelity of the final product and the size of the product span that can be amplified. Methods developed for PCR amplification of long DNA fragments include the PCR performed with mixed DNA polymerase[22,23], and PCR with addition of internal primers[24].The addition of internal primers is found to be helpful to obtain full length DNA. When these primers anneal to a template of full length,each primer can be extended at3 -end to reach the5 -end of the next primer; and these short DNA fragments will be released at the1st step of the next thermal cycle,i.e.denaturation,In the next cycle,the frag-ments of3 -end defect will be further extended after they anneal to new templates,while those of5 -end defect are not reparable in vitro.In this study,we are exploring a method to use thermostable DNA ligase to promote the long DNA amplification by PCR.Ther-mostable DNA ligase can close the nicks in the chain newly synthesized from two or more primers after a repetitive series of the four fundamental steps:denaturation,annealing,extension and ligation.To confirm the function of Tma DNA ligase,three adjacent fragments were amplified in the presence or the absence of DNA ligase,so that ligation and disconnection between adjacent frag-ments were clearly displayed(Fig.5).The results show that the DNA ligase significantly increased the production of long fragments (Fig.6),and DNA sequencing data indicate that no error bases were incorporated into the ligation sites(data not shown).However, in practical applications,we would recommend that the primers should be designed to produce overlapped fragments.We have also realized that the DNA polymerases producing blunt-end fragments, e.g.Vent,or Pyrobest DNA polymerase are preferred,because the3 A-ended small fragments amplified from small templates would not be extensible after they annealed to the overlapped ones.In summary,this work has revealed several properties of the NAD+-dependent DNA ligase from the thermophilic bacterium T. maritima.Tma DNA ligase combined characteristics of high thermal stability and broad pH profile.A simple,easy to perform method was designed to amplify long DNA fragments with the involvement of Tma DNA ligase.AcknowledgementsThis work was supported by a“973”Grant2004CB719600from China.References[1]Lehman IR.DNA ligase:structure,mechanism,and function.Science1974;186:790–7.[2]Timson DJ,Singleton MR,Wigley DB.DNA ligases in the repair and replicationof DNA.Mutat Res2000;460:301–18.[3]Doherty AJ,Wigley DB.Functional domains of an ATP-dependent DNA ligase.JMol Biol1999;285:63–71.[4]Timson DJ,Wigley DB.Functional domains of an NAD+-dependent DNA ligase.J Mol Biol1999;285:73–83.[5]Barany F.Genetic disease detection and DNA amplification using cloned ther-mostable ligase.Proc Natl Acad Sci USA1991;88:189–93.[6]Takahashi M,Yamaguchi E,Uchida T.Thermophilic DNA ligase.Purificationand properties of the enzyme from Thermus thermophilus HB8.J Biol Chem 1984;259:10041–7.[7]Jeon HJ,Shin HJ,Choi JJ,Hoe HS,Kim HK,Suh SW,et al.Mutational analyses ofthe thermostable NAD+-dependent DNA ligase from Thermusfiliformis.FEMS Microbiol Lett2004;237:111–8.[8]Lai X,Shao H,Hao F,Huang L.Biochemical characterization of an ATP-dependent DNA ligase from the hyperthermophilic crenarchaeon Sulfolobus shibatae.Extremophiles2002;6:469–77.[9]Thorbjarnardóttir SH,Jónsson ZO,AndréssonÓS,Kristjánsson JK,Eggertsson G,Palsdottir A.Cloning and sequence analysis of the DNA ligase-encoding gene of Rhodothermus marinus,and overproduction,purification and characterization of two thermophilic DNA ligases.Gene1995;161:1–6.[10]Seo MS,Kim YJ,Choi JJ,Lee MS,Kim JH,Lee JH,et al.Cloning and expression ofa DNA ligase from the hyperthermophilic archaeon Staphylothermus marinusand properties of the enzyme.J Biotechnol2007;128:519–30.[11]Jeon SJ,Ishikawa K.A novel ADP-dependent DNA ligase from Aeropyrum pernixK1.FEBS Lett2003;550:69–73.[12]Lim JH,Yu YG,Han YS,Cho S,Ahn BY,Kim SH,et al.Molecular cloning andcharacterization of thermostable DNA ligase from Aquifex pyrophilus,a hyper-thermophilic bacterium.Extremophiles2001;5:161–8.[13]Brannigan JA,Ashford SR,Doherty AJ,Timson DJ,Wigley DB.Nucleotidesequence,heterologous expression and novel purification of DNA ligase from Bacillus stearothermophilus.Biochim Biophys Acta1999;1432:413–8.[14]Nelson KE,Clayton RA,Gill SR,Gwinn ML,Dodson RJ,Haft DH,et al.Evidence forlateral gene transfer between Archaea and Bacteria from the genome sequence of Thermotoga maritima.Nature1999;399:323–9.[15]Jiang Y,Zhou Q,Wu K,Li XQ,Shao WL.A highly efficient method for liquid andsolid cultivation of the anaerobic hyperthermophilic eubacterium Thermotoga maritima.FEMS Microbiol Lett2006;259:254–9.[16]Frederick M,Ausubel,Brent R,Kingston RE,Moore DD,Seidman JG,et al.Shortprotocols in molecular biology.3rd ed.New York:John Wiley&Sons;1995. [17]Shao W,Wu H,Pei J.A plasmid vector controlled by the Sigma32factor ofEscherichia coli and its use for the expression of heterologous protein.Interna-tional Patent2006;PCT WO2006/002574A1.[18]Yang YT,Wu CSC,Martinez HM.Calculation of protein conformation from cir-cular dichroism.Methods Enzymol1986;130:208–57.[19]Sutton DW,Havstad PK,Kemp JD.Synthetic crylllA gene from Bacil-lus thuringiensis improved for high expression in plants.Transgenic Res 1992;1:228–36.[20]Xiong AS,Peng RH,Zhuang J,Liu JG,Gao F,Chin JM,et al.Non-polymerase-cycling-assembly-based chemical gene synthesis:Strategies,methods,and progress.Biotechnol Adv2008;26:121–34.[21]Smith HO,Hutchison CA,Pfannkoch C,Venter JC.Generating a syntheticgenome by whole genome assembly:ØX174bacteriophage from synthetic oligonucleotides.Proc Natl Acad Sci USA2003;100:15440–5.[22]Cheng S,Fockler C,Barnes WM,Higuchi R.Effective amplification of long tar-gets from cloned inserts and human genomic DNA.Proc Natl Acad Sci USA 1994;91:5695–9.[23]Barnes WM.PCR amplification of up to35-kb DNA with highfidelity and highyield from bacteriophage templates.Proc Natl Acad Sci USA1994;91:2216–20.[24]Nikolai A,Shevchuk,Anton V,Bryksin,Yevgeniya A.Nusinovich.Construc-tion of long DNA molecules using long PCR-based fusion of several fragments simultaneously.Nucleic Acids Res2004;32:e19.。