Rhythmic Parsing of Sonified DNA and RNA Sequences

poetry诗歌英语Poetry, as one of the most beautiful forms of literary expression, holds a special place in the world of literature. It is a means of communicating emotions, ideas, and experiences through carefully crafted words. Here, in this document titled "Poetry: The Art of English Verse," we will explore the essence, elements, and significance of poetry. 1. Introduction to PoetryPoetry is a form of artistic expression that utilizes the power of language to bring forth emotions, provoke thoughts, and create vivid imagery. It has been an integral part of human culture for centuries, with its origins dating back to ancient times. The use of poetic devices such as rhyme, rhythm, and metaphor elevates ordinary words into extraordinary works of art.2. The Elements of PoetryTo understand and appreciate poetry, it is essential to familiarize oneself with its fundamental elements. These include:2.1. Rhyme: The repetition of sounds at the end of words gives poetry a musical quality. Rhymes can be perfect, where the ending sounds match precisely, or slant, where there is a partial match.2.2. Rhythm: The pattern of stressed and unstressed syllables in a line of poetry creates its rhythmic flow. Different poetic forms, such as sonnets or haikus, have specific rhythmic structures.2.3. Metaphor: A figure of speech that compares two unrelated things, allowing readers to see the familiar in anew light. Metaphors enrich the imagery and deepen the meaning of a poem.2.4. Imagery: The use of descriptive language that appeals to the senses, allowing readers to visualize thepoet's words. Through vivid imagery, poems create a sensory experience for the readers.3. The Significance of PoetryPoetry serves various purposes and holds immense significance in our lives. It enables us to:3.1. Express Emotions: Poetry offers a unique platform to channel emotions, be it love, sorrow, joy, or despair. It allows individuals to express their innermost thoughts and feelings in a profound and relatable manner.3.2. Capture Moments: Through carefully chosen words and evocative imagery, poems capture fleeting moments and experiences, freezing them in time. This ability to encapsulate specific moments makes poetry a powerful tool for storytelling.3.3. Challenge Perspectives: Poems have the power to challenge established norms and provoke new ways of thinking. They encourage readers to question societal boundaries and encourage individuality of thought.3.4. Preserve Culture: Poetry plays a vital role in preserving cultural heritage and traditions. It serves as a medium through which stories, beliefs, and values are passed down from one generation to another.4. ConclusionIn conclusion, poetry stands as a testament to human creativity, emotion, and imagination. Through the careful manipulation of language, poets create works that resonate with readers on a profound level. This document aimed toprovide a brief insight into the art of English verse, highlighting its elements and significance. Remember, poetry is not merely words on a page but a gateway to explore the depth and beauty of the human experience.。

Evolution through either natural selection or genetic drift is dependent on variation at the genetic and mor-phological levels. Processes that influence the genetic structure of populations include mating systems, effective population size, mutation rates and gene flow among populations. We investigated the patterns of population genetic structure of orchids and evaluated if evolutionary processes are more likely at the indi-vidual population level than at the multipopulation/species level. We hypothesized that because orchid populations are frequently small and reproductive success is often skewed, we should observe many orchids with high population genetic substructure suggesting limited gene flow among pop-ulations. If limited gene flow among populations is a common pattern in orchids, then it may well be an important component that affects the likelihood of genetic drift and selection at the local population level. Such changes may lead to differentiation and evolu-tionary diversification.A main component in evolutionary processes is the necessary condition of isolation. The amount of gene flow among local populations will determine whether or not individual populations (demes) can evolve inde-pendently which may lead to cladogenesis. Usually one migrant per generation is sufficient to prevent populations from evolving independently from other populations when effective population sizes are large. Theoretically, if the gene flow rate, Nm (the effective number of migrants per generation; N = effective pop-ulation size, m = migration rate), is larger than two individuals per generation, then it is sufficient to pre-vent local adaptation while gene flow less than one per generation will likely result in population differen-tiation by selection or genetic drift (Merrell 1981, Roughgarden 1996). If Nm lies between one and two, there will be considerable variation in gene frequen-cies among populations (Merrell 1981). Consequently,populations will have similar genetic structure as if mating were panmictic (Nm >2). Alternatively, if gene flow is low (Nm < 1), populations will have different genetic structures that may result in evolutionary change through either adaptation to the local environ-ments via natural selection or through random effects such as genetic drift.Direct observation of gene flow can be viewed by the use of mark and recapture studies (for mobile organisms, or stained pollen) or tracking marker alle-les (paternity analysis) over a short number of genera-tions. Few orchid studies have attempted to directly observe gene flow and thus far only staining or micro-tagging pollinaria have been used (Peakall 1989, Nilsson et al.1992, Folsom 1994, Tremblay 1994, Salguero-Faría & Ackerman 1999). All these studies examined gene flow only within populations. Indirect methods for detecting gene flow are obtained from allele frequencies and are an estimate of the average long-term effect of genetic differentiation by genetic drift. The alleles are assumed to be neutral so that genetic differentiation based on these markers would be a consequence of drift rather than natural selection. Bohomak (1999) concluded that simple population genetic statistics are robust for inferring gene flow among groups of individuals.The most common approach is the degree of popula-tion differentiation at the genetic level using Wright’s F estimates on data obtained through protein elec-trophoresis or various PCR type approaches. The F statistics separate the amount of genetic variation which can be attributed to inbreeding among closely related individuals in a population: FIS is the inbreed-ing coefficient within individuals; FIT is the result of non random mating within a population and the effect of population subdivision; and a third statistic, FST, is the fixation index due to random genetic drift and the lack of panmixia among populations (Wright 1978).THE GENETIC STRUCTURE OF ORCHID POPULATIONSAND ITS EVO L U T I O N A R Y IMPORTA N C ER AYMOND L. T REMBLAY1,3&J AMES D. A CKERMAN21University of Puerto Rico – Humacao, Department of Biology, Humacao, Puerto Rico, 00791, U.S.A.2University of Puerto Rico – Río Piedras, Department of BiologyP.O. Box 23360, San Juan, Puerto Rico, 00931-3360, U.S.A.3Author for correspondence: raymond@LANKESTERIANA 7: 87-92. 2003.LANKESTERIANA SpeciesReferencesNm(W)Gst Calypso bulbosa (L.) Oakes Alexandersson & Ågren 2000 3.200.072Caladenia tentaculata TatePeakall & Beattie 19967.1010.0346Cephalanthera damasonium (Mill.) Druce Scacchi, De Angelis & Corbo 1991--5--5C ephalanthera longifolia (L.) Fritsch Scacchi, De Angelis & Corbo 1991 2.1510.104Cephalanthera rubra (L.) Rich.Scacchi, De Angelis & Corbo 19910.7610.247Cymbidium goeringii Rchb. f.Chung & Chung 1999 2.300.098Cypripedium acaule Ait.Case 19941.2710.164Cypripedium calceolus L.Case 1993, 1994 1.6310.196Cypripedium candidum Muhl. ex Willd.Case 19943.3710.069Cypripedium fasciculatum Kellogg ex S. Watson Aagaard, Harrod & Shea 1999 6.000.04Cypripedium kentuckiense C. F. Reed Case et al.1998 1.1210.182Cypripedium parviflorum Salisb.var. pubescens (Willd.) O. W. Knight Case et al.19981.2810.163Southern populations Wallace & Case 20000.940.209Northern populations1.570.137var. makasin (Farw.) Sheviak 1.000.199var parviflorum 1.430.149species level0.830.232Cypripedium reginae WalterCase 19940.4710.349Dactylorhiza romana (Sebastiani) SoóBullini et al.2001 3.3210.07Dactylorhiza sambucina (L.) SoóBullini et al.20011.3110.16Epidendrum conopseum R. Br.Bush, Kutz & Anderton 19991.4330.149Epipactis helleborine (L.) Crantz Scacchi, Lanzara & De Angelis 19877.310.033European populations Squirrell et al., 20011.0010.2000.241,40.5064North AmericanHollingsworth & Dickson 19970.09042.5310.2400.791Epipactis youngiana Richards & Porter Harris & Abbott 1997 2.4310.093Eulophia sinensis Miq.Sun & Wong 2001---0.00.1331,30.6533Gooyera procera Ker-Gawl.Wong & Sun 19990.22110.5230.3971,30.3863Gymnadenia conopsea (L.) R. Br.Scacchi & De Angelis 19900.28010.471Gymnadenia conopsea (L.) R. Br. conopsea Soliva & Widmer 19992.960.078Gymnadenia conopsea (L.) R. Br.subsp densiflora (Wahl) E.G. Camus & A. Camus Soliva & Widmer 19990.390.391Lepanthes caritensis Tremblay & Ackerman Carromero, Tremblay & Ackerman 1.300.167(unpublished)Lepanthes rupestris Stimson Tremblay & Ackerman 2001 1.840.170Lepanthes rubripetala Stimson Tremblay & Ackerman 20010.620.270Lepanthes eltoroensis Stimson Tremblay & Ackerman 20010.890.220Lepanthes sanguinea Hook.Carromero, Tremblay & Ackerman 1.450.144(unpublished)Table 1. Estimates of gene flow in orchids. Nm(W) = gene flow estimates based on Wright’s statistics; Gst coeff-cient of genic differentiation among populations. 1Nm calculated by the present authors from Gst or Fst using formula on p. 320 of Hartl & Clark (1989). 2Recalculated using previous formula, original Nm value 3.70. 3Calculated from RAPD markers. 4Calculated from cpDNA. 5No genetic differentiation found among populations. 6Calculated according to Weir and Cockerham’s statistics. 7. Estimated using RAPD’s and AMOVA.88Nº 7T REMBLAY&A CKERMAN- Genetic structure of orchid populationsConsequently, if we make the assumption that the genetic markers sampled are neutral or nearly neutral and that the observed level of FST is a measure of the current gene flow among populations (rather than a historical remnant), then we can evaluate the likelihood that populations are effectively isolated. The scale of FST is from 0 (no population subdivision) to 1.0 (com-plete genetic differentiation among populations).We gathered population genetic data for 58 species of terrestrial and epiphytic orchids from temperate and tropical species. The data are biased toward ter-restrial/temperate species (N = 44). We found only three studies of terrestrial/tropical species and ten epi-phytic/tropical. There is also a bias toward certain taxa: Orchis, Cypripedium, Pterostylis and Lepanthes account for nearly half (30) of the 61 records (Table 1), 10 species of O r c h i s, 7 species each of Cypripedium and Pterostylis, 6 species of Lepanthes,3 species of S p i r a n t h e s, Epipactis, Cephalantheraa n d G y m n a d e n i a, 2 species of D a c t y l o r h i z a, Epipactis, Vanilla and Zeuxine, and one species each of Caladenia, Calypso, Cymbidium, Epidendrum, Eulophia, Goodyera, Nigritella, Paphiopedilum, Platanthera, Tipularia, and Tolumnia.89Mayo 2003Gene flow among populations varies among species ranging from a high of 12 effective migrants per gen-eration in Orchis longicornu(Corrias et al. 1991) to lows of less then 0.2 in Zeuxine strateumatica(Sun & Wong 2001). Assembling the species in groups based on their estimates of gene flow, we note that 18 species have less then one migrant per generation, while 19 species have more than two migrants per generation, and 17 of the species have a migration rates between one and two. No genetic differentiation was found among populations for C e p h a l a n t h e r a d a m a s o n i u m(Scacchi, De Angelis & Corbo 1991) and Spiranthes hongkongensis(Sun 1996). Consequently these two species are excluded from further analysis.O r c h i s species typically have high estimates of gene flow among populations (Scacchi, De Angelis & Lanzara 1990, Corrias et al. 1991, Rossi et al. 1992) whereas Lepanthes and Pterostylis species have much lower gene flow estimates (Tremblay & Ackerman 2001, Sharma, Clements & Jones 2000; Sharma et al.2001). However even within a genus variation in gene flow can be extensive (Table 1).Are there phylogenetic associations with gene flow? The data for O r c h i s(mean Nm = 5.7), L e p a n t h e s(mean Nm = 2.1) and P t e r o s t y l i s( m e a n Nm = 1.0) are suggestive, but much more extensive sampling is needed for both temperate and tropical species. Curiously, L e p a n t h e s and O r c h i s have very different population genetic parameters yet both are species-rich genera and are likely in a state of evolu-tionary flux. It seems to us that orchids have taken more than one expressway to diversification. For the group of species which has more than 2 migrants per generation local populations will not evolve indepen-dently, but as a group, consequently local morpholog-ical and genetic differences among groups will be wiped out, and populations will become homoge-neous if gene flow continues at the level. When gene flow is high, selection studies from different popula-tions should be evaluated together (Fig. 1).For populations that have less than one migrant perLANKESTERIANAFigure 1: Distribution of mean (s.e.) gene flow (Nm) among genera of Orchids. Bars without error bars of single datap o i n t s.90Nº 7T REMBLAY&A CKERMAN- Genetic structure of orchid populationsgeneration, local populations can evolve independent-ly, and evolutionary studies should be done at the local level. In small populations, we may expect genetic drift to be present and selection coefficients should be high to counteract the effects of drift.For species with intermediate gene flow it is proba-bly wise to evaluate evolutionary processes at the local and multi-population/species level. We expect variance in migration rates to be large because of the skewed reproductive success among individuals, time periods and populations. Consequently, the outcome of the evolutionary process will likely depend on the amount and variation of the migration events and consistency in migration rates in time. If variance in gene flow through space and time is small, then the genetic dif-ferentiation will be more or less stable. But, for exam-ple, if variance in gene flow is high, with some periods having high gene flow followed by little or no gene flow for an extended period of time, it is possible that through natural selection and genetic drift local popula-tions might differentiate sufficiently for cladogenesis during the period of reduced immigration.Species with less than one migrant per population are basically unique evolutionary units evolving inde-pendently from other local populations. In popula-tions with large Ne (> 50), it is likely that natural selection will dominate evolutionary processes while if Ne is small (< 50) genetic drift and selection can both be responsible for evolution. Consequently for these species, local adaptation to specific environ-mental conditions is possible.This survey of population genetics studies of orchids shows that multiple evolutionary processes have likely been responsible for the remarkable diver-sification in orchids.L ITERATURE C ITEDAagaard J.E., R.J. Harrod & K.L. Shea. 1999. Genetic vari-ation among populations of the rare clustered lady-slip-per orchid (Cypripedium fasciculatum) from Washington State, USA. Nat. Areas J. 19: 234-238Ackerman J.D. & S. Ward. 1999. Genetic variation in a widespread epiphytic orchid: where is the evolutionary potential? Syst. Bot. 24: 282-291.Alexandersson, R. & J. Ågren. 2000. Genetic structure of the nonrewarding bumblebee pollinated Calypso bul-bosa. Heredity 85: 401-409Arduino, P., F. Verra, R. Cianchi, W. Rossi, B. Corrias, & L. Bullini. 1996. Genetic variation and natural hybridization between Orchis laxiflora and O r c h i s palustris(Orchidaceae). Pl. Syst. Evol. 202: 87-109. Arft, A.M. & T.A. Ranker. 1998. Allopolyploid origin and population genetics of the rare orchid Spiranthes diluvi-alis. Am. J. Bot. 85: 110-122.Bohomak, A.J. 1999. Dispersal, gene flow, and population structure. Quart. Rev. Biol. 74: 21-45.Bullini, L., R. Cianchi, P. Arduino, L. De Bonis, M. C. Mosco, A. Verdi, D. Porretta, B. Corrias & W. Rossi. 2001. Molecular evidence for allopolyploid speciation and a single origin of the western Mediterranean orchid Dactylorhiza insularis(Orchidaceae). Biol. J. Lin. Soc. 72: 193-201.Bush, S.T., W.E. Kutz & J.M. Anderton. 1999. RAPD variation in temperate populations of epiphytic orchid Epidendrum conopseum and the epiphytic fern Pleopeltis polypodioides. Selbyana 20: 120-124. Case, M.A. 1993. High levels of allozyme variation within Cypripedium calceolus(Orchidaceae) and low levels of divergence among its varieties. Syst. Bot. 18: 663-677. Case, M.A. 1994. Extensive variation in the levels of genetic diversity and degree of relatedness among five species of Cypripedium(Orchidaceae). Amer. J. Bot. 81: 175-184.Case, M.A., H.T. Mlodozeniec, L.E. Wallace & T.W. Weldy. 1998. Conservation genetics and taxonomic sta-tus of the rare Kentucky Lady’s slipper: C y p r i p e d i u m k e n t u c k i e n s e(Orchidaceae). Amer. J. Bot. 85: 1779-1779.Chung, M.Y. & M.G. Chung. 1999. Allozyme diversity and population structure in Korean populations of Cymbidium goeringii(Orchidaceae). J. Pl. Res. 112: 139-144.Corrias, B., W. Rossi, P. Arduino, R. Cianchi & L. Bullini. 1991. Orchis longicornu Poiret in Sardinia: genetic, morphological and chronological data. Webbia 45: 71-101.Folsom, J.P. 1994. Pollination of a fragrant orchid. Orch. Dig. 58: 83-99.Harris, S.A. & R. J. Abbott. 1997. Isozyme analysis of the reported origin of a new hybrid orchid species, Epipactis y o u n g i a n a(Young’s helleborine), in the British Isles. Heredity 79: 402-407.Hedrén, M., E. Klein & H. Teppner. 2000. Evolution of polyploids in the European orchid genus N i g r i t e l l a: Evidence from allozyme data. Phyton 40: 239-275. Hollingsworth, P.M. & J.H. Dickson. 1997. Genetic varia-tion in rural and urban populations of Epipactis helle-b o r i n e(L.) Crantz. (Orchidaceae) in Britain. Bot. J. Linn. Soc. 123: 321-331.Li, A, Y., B. Luo & S. Ge. 2002. A preliminary study on conservation genetics of an endangered orchid (Paphiopedilum micranthum) from Southwestern China. Bioch. Gen. 40: 195-201.Merrell, D.J. 1981. Ecological Genetics. University of Minnesota Press, Minneapolis, Minnesota.Nielsen, L.R. & H.R. Siegismund. 2000. Interspecific dif-ferentiation and hybridization in V a n i l l a s p e c i e s (Orchidaceae). Heredity 83: 560-567.91Mayo 2003LANKESTERIANANilsson, L.A., E. Rabakonandrianina & B. Pettersson. 1992. Exact tracking of pollen transfer and mating in plants. Nature 360: 666-667.Peakall, R. 1989. A new technique for monitoring pollen flow in orchids. Oecologia 79: 361-365.Peakall, R. & A. J. Beattie. 1996. Ecological and genetic consequences of pollination by sexual deception in the orchid Caladenia tentaculata. Ecology 50: 2207-2220. Rossi, W., B. Corrias, P. Arduino, R. Cianchi & L. Bullini L. 1992. Gene variation and gene flow in Orchis morio (Orchidaceae) from Italy. Pl. Syst. Evol. 179: 43-58. Roughgarden, J. 1996. Theory of population genetics and evolutionary ecology: An Introduction. Prentice Hall, Upper Saddle River, NJ, USA.Salguero-Faría, J.A. & J.D. Ackerman. 1999. A nectar reward: is more better? Biotropica 31: 303-311. Scacchi, R., G. De Angelis & R.M. Corbo. 1991. Effect of the breeding system ion the genetic structure in C e p h a l a n t h e r a spp. (Orchidaceae). Pl. Syst. Evol. 176: 53-61.Scacchi, R., G. De Angelis & P. Lanzara. 1990. Allozyme variation among and within eleven Orchis species (fam. Orchidaceae), with special reference to hybridizing apti-tude. Genetica 81: 143-150.Scacchi, R. and G. De Angelis. 1990. Isoenzyme polymor-phisms in G y m n a e d e n i a[sic] c o n o p s e a and its infer-ences for systematics within this species. Bioch. Syst. Ecol. 17: 25-33.Scacchi, R., P. Lanzara & G. De Angelis. 1987. Study of electrophoretic variability in Epipactis heleborine ( L.) Crantz, E. palustris(L.) Crantz and E. microphylla (Ehrh.) Swartz (fam. Orchidaceae). Genetica 72: 217-224.Sharma, I.K., M.A. Clements & D.L. Jones. 2000. Observations of high genetic variability in the endan-gered Australian terrestrial orchid Pterostylis gibbosa R. Br. (Orchidaceae). Bioch. Syst. Ecol. 28: 651-663. Sharma, I.K., D.L. Jones, A.G. Young & C.J. French. 2001. Genetic diversity and phylogenetic relatedness among six endemic P t e r o s t y l i s species (Orchidaceae; series Grandiflorae) of Western Australia, as revealed by allozyme polymorphisms. Bioch. Syst. Ecol. 29: 697-710.Smith, J.L., K.L. Hunter & R.B. Hunter. 2002. Genetic variation in the terrestrial orchid Tipularia discolor. Southeastern Nat. 1: 17-26Soliva, M. & A. Widmer A. 1999. Genetic and floral divergence among sympatric populations of Gymnadenia conopsea s.l. (Orchidaceae) with different flowering phenology. Int. J. Pl. Sci. 160: 897-905. Squirrell, J., P.M. Hollingsworth, R.M. Bateman, J.H. Dickson, M.H.S. Light, M. MacConaill & M.C. Tebbitt. 2001. Partitioning and diversity of nuclear and organelle markers in native and introduced populations of Epipactis helleborine(Orchidaceae). Amer. J. Bot. 88: 1409-1418.Sun, M. 1996. Effects of Population size, mating system, and evolution origin on genetic diversity in S p i r a n t h e s sinensis and S. hongkongensis. Cons. Biol. 10: 785-795. Sun, M. & K.C. Wong. 2001. Genetic structure of three orchid species with contrasting breeding system using RAPD and allozyme markers. Amer. J. Bot. 88: 2180-2188.Tremblay, R.L. 1994. Frequency and consequences of multi-parental pollinations in a population of Cypripedium calceolus L. var. pubescens(Orchidaceae). Lindleyana 9: 161-167.Tremblay, R.L & J.D. Ackerman. 2001. Gene flow and effective population size in Lepanthes(Orchidaceae): a case for genetic drift. Biol. J. Linn. Soc. 72: 47-62. Wallace, L.A. 2002. Examining the effects of fragmenta-tion on genetic variation in Platanthera leucophaea (Orchidaceae): Inferences from allozyme and random amplified polymorphic DNA markers. Pl. Sp. Biol 17: 37-39.Wallace, L.A. & M. A. Case. 2000. Contrasting diversity between Northern and Southern populations of Cypripedium parviflorum(Orchidaceae): Implications for Pleistocene refugia and taxonomic boundaries. Syst. Bot. 25: 281-296.Wong, K.C. & M. Sun. 1999. Reproductive biology and conservation genetics of Goodyera procera (Orchidaceae). Amer. J. Bot. 86: 1406-1413.Wright, S. 1978. Evolution and the genetics of popula-tions. Vol. 4. Variability within and among natural pop-ulations. Chicago, The University of Chicago Press.Raymond L. Tremblay is an associate professor at the University of Puerto Rico in Humacao and the graduate faculty at UPR- Río Piedras. He obtained his B.Sc. with Honours at Carleton University, Ottawa, Canada in 1990 and his PhD at the University of Puerto Rico in Rio Piedras in 1996. He is presently the chairman of the In situ Orchid Conservation Committee of the Orchid Specialist Group. He is interested in evolutionary and con-servation biology of small populations. Presently his interest revolves in determining the life history characters that limit population growth rate in orchids and evaluating probability of extinction of small orchid populations. James D. Ackerman, Ph.D., is Senior Professor of Biology at the Univesrity of Puerto Rico, Río Piedras. He is an orchidologist, studying pollination an systematics.92Nº 7。

生化历来都不画重点的，但留学生老是过不了，于是就有了这个重点资料，和我们考的差不多，但是英语的，求高人翻译啊Brief Exercises of BiochemistryChapter 1 The structure and function of proteinExplain the following terms1. peptide bond2. Amino acid residues3. Primary structure of protein4. isoelectric point5. Secondary structure of protein6. Tertiary structure of protein7. Domain8. Protein denaturation9. Quaternary structure of proteinAnswer the following questions briefly1. What is physiological significance of hemoglobin oxygen dissociation curve as S-shaped?2. Please describe physiological functions of proteins.Discuss the following questions (Essay questions)1. Explain the relationship between the primary and spatial structure and the function of protein.Chapter 2 The structure and function of nucleic acidsExplain the following terms1. primary structure of nucleic acids2. DNA denaturation3. Tm4. DNA renaturation5. nucleic acid hybridizationAnswer the following questions briefly1. What is the structural characteristics of an eukaryocyte mature mRNA?2. What is the biological significance of Tm?Discuss the following questions (Essay questions)1. Please compare the two types of nucleic acids (DNA and RNA) in the chemical composition, molecular structure, cell distribution and biological functions.2. Please describe the structural characteristics of the B-DNA.3. Describe the molecular composition, structural features and functions of tRNA.Chapter 3 EnzymeExplain the following terms1. enzyme2. enzyme active center3. enzyme competitive inhibition4. Km5. isoenzyme6. zymogen activationAnswer the following questions briefly1. Explains with examples the competitive inhibition characteristic and the practical significance.2. What is the relationship between the enzyme cofactor and vitamine?3. What is the physiological significance of zymogen?4. What is isoenzyme? What is clinical significance of isoenzyme?5. How many kinds of essential group of enzyme are there? What is the role of each?Chapter 4 Metabolism of carbohydrateExplain the following terms1. glycolysis2. glycolytic pathway3. tricarboxylic acid cycle4. gluconeogenesis5. blood sugarAnswer the following questions briefly1. Describe briefly source and fate of blood sugar2. Describe briefly the physiological significance of gluconeogenesis3. Describe briefly the physiological significance of glycolysis4. Describe briefly the outline of TCA cycle5. Describe briefly the physiological significance of TCA cycle6. Describe briefly the physiological significance of pentose phosphate pathway7. Outline the reasons for the formation of lactic acid cycle and the physiological significance.8. Overview the important role of B vitamins in glucose metabolism.9. Why 6-phosphate glucose dehydrogenase activity will increase after uptake high-carbohydrate diet?Discuss the following questions (Essay questions)1. Explain how is lactate converted into glucose? (Write down the main reactions and key enzymes)2. Explain how is lactate converted into CO2, H2O and releases ATP? (Write down the main reactions and key enzymes)3. Overview the regulation molecular mechanism of adrenaline on the blood sugar level.4. Please explain why a slimmer has to reduce the intake of carbohydrates from the point of view of nutrients metabolism. (Write down the related pathways, cellular localization, main reactions and key enzyme)Chapter 5 Metabolism of lipidsExplain the following terms1. fat mobilization2. ketone body3. plasma lipoprotein4. apolipoprotein5. essential fatty acid6. blood lipidsAnswer the following questions briefly1. What is the function of bile acid at lipids digestion?2. What is the physiological significance of ketone body generation?3. What are materials of fatty acid synthesis?4. What is the physiological significance of cholesterol?5. What are the functions of apolipoprotein?Discuss the following questions (Essay questions)1. Describe the sources, chemical composition characteristics and main physiological functions of plasma lipoprotein.2. Explain how is the stearic acid converted into CO2, H2O and releases ATP?3. Please describe the oxidation catabolism process of glycerol generated from fat mobilization4. Explain how is the glycerol converted into glycogen?5. Describe the source and fate of acetyl-CoA?Chapter 6 Biological oxidationExplain the following terms1. biological oxidation2. respiratory chain3. oxidative phosphorylation4. substrate level phosphorylationDiscuss the following questions (Essay questions)1. Write down the sequence of two respiratory chainChapter 7 Metabolism of amino-acidExplain the following terms1. essential amino acid2. deamination of amino acid3. transamination of amino acid4. one carbon unit5. hyperammonemiaAnswer the following questions briefly1. What is the physiological significance of one carbon units?2. What is meaning of PAPS, GABA, SAM and FH4 each?3. Write down the deamination of amino acids in vivo.4. Outline the source and fate of blood ammonia.Discuss the following questions (Essay questions)1. How does a glutamate be oxidized to supply energy? What is the final product?2. What are functions of vitamins B in the metabolism of amino acids?3. Use the alanine as an example, try to explain the gluconeogenesis process of glucogenic amino acids.Chapter 8 Metabolism of nucleotideExplain the following terms1. de novo synthesis pathway of purine nucleotide2. nucleotide antimetaboliteAnswer the following questions briefly1. Outline the biological function of nucleotide.2. Outline the physiological significance of salvage synthesis of purine nucleotide.Discuss the following questions (Essay questions)1. Use the 6-mercaptopurine as an example, please explain the mechanism of antimetabolite.Chapter 10 Biosynthesis of DNAExplain the following terms1. semi-conservative replication2. reverse transcription3. replication4. excision repairing5. frame-shift mutationAnswer the following questions briefly1. Outline the classification and function of prokaryote DNA polymerase.2. Outline the classification and function of eukaryote DNA polymerase.3. Outline the factors causing DNA damage.4. Outline the repairing of DNA damage.5. Outline the central dogma.Discuss the following questions (Essay questions)1. Describe the materials involved in prokaryote DNA replication and their functions in that process.2. Describe the biological significance of mutation.Chapter 11 Biosynthesis of RNAExplain the following terms1. transcription2. posttranscriptional process3. hnRNA4. promoter5. ribozyme6. structure geneAnswer the following questions briefly1. Outline the eukaryote posttranscriptional process.2. Outline the products of three kinds of eukaryote RNA polymerases.Discuss the following questions (Essay questions)1. Describe the similarity and dissimilarity of replication and transcription.Chapter 12 Biosynthesis of proteinExplain the following terms1. translate2. polyribosomes3. genetic code4. degeneracy of codonAnswer the following questions briefly1. Describe briefly the RNAs involved in the protein synthesis and their functions in that process.2. Outline the main features of the genetic code.3. Describe briefly the dissimilarity of translation initiation complex formation of prokaryotes and eukaryotes.Discuss the following questions (Essay questions)1. Describe the materials involved in protein biosynthesis and their functions in that process.3. Please comparing the process of translation of prokaryotes and eukaryotes.Chapter 13 The regulation of gene expressionExplain the following terms1. gene expression2. cis-acting element3. trans-acting factor4. operon5. general transcription factor6. enhancerAnswer the following questions briefly1. What is biological significance of regulation of gene expression?2. Outline the function of each component of operon.3. What characteristics does eukaryotic genome structure have?Discuss the following questions (Essay questions)1. Explain the regulation mechanism of lactose operon.Chapter 14 Gene recombination and gene engineeringExplain the following terms1. restriction endonuclease2. genomic DNA3. vector4. cDNA. library5. genetic engineering6. DNA cloning7. homologous recombinationAnswer the following questions briefly1. What are the main selection criteria of gene vector?2. What is the significance of restriction endonuclease of bacteria themselves?3. At present, How many ways to get target genes?4. Outline the basic process of DNA cloning.Discuss the following questions (Essay questions)1. Why plasmid can be used as the vector of genetic engineering?2. Explain how to connect the foreign gene and the vector.3. What is α-complementary? Explain how to screening recombinant by it using an example.Chapter 15 Cellular signal transductionExplain the following terms1. signal transduction2. receptor3. ligand4. signal transduction pathway5. protein kinase6. second messenger7. G proteinAnswer the following questions briefly1. Describe briefly which protein kinases are regulated by intracellular second messenger.2. Outline the classification of receptor and its chemical signals.3. Describe briefly the basic mode of G protein-coupled receptor (seven transmembrane receptor)-mediated signal transduction.4. Describe briefly the signal transduction pathway of intracellular receptor of steroid hormone.Discuss the following questions (Essay questions)1. How does intracellular receptor play its function?2. Explain the process of the glycogen metabolism regulated by glucagon.3. Use fat mobilization as an example, explain the process of cAMP-protein kinase pathway. Chapter 16 Blood biochemistryExplain the following terms1. 2, 3-BPG shuntAnswer the following questions briefly1. Outline the function of plasma protein.Chapter 17 Liver biochemistrExplain the following terms1 biotransformation 2. primary bile acid 3. secondary bile acid4. bile pigment5. jaundiceAnswer the following questions briefly1. Describe briefly the physiological significance of biotransformation.2. Outline the main physiological functions of bile acids.3. Describe briefly production and blood transportation of bilirubin.Discuss the following questions (Essay questions)1. Describe the influence factor of biotransformation.2. Explain the dissimilarity of unconjugated and conjugated bilirubin.Chapter 18VitaminsExplain the following terms1. vitamin2. lipid-soluble vitamin3. water-soluble vitaminAnswer the following questions briefly1. Outline the biochemical function of vitamin E.2. Describe briefly the biochemical function of vitamin D and its deficiency disease.Discuss the following questions (Essay questions)1. Explain the relationship between the water-soluble vitamin and the coenzyme. Chapter 20 Oncogenes, tumor suppressor genes and growth factorExplain the following terms1. oncogene2. proto-oncogene3. tumor suppressor geneAnswer the following questions briefly1. Describe characteristics of proto-oncogene.2. Describe briefly wild-type p53 tumor suppressor gene mechanism.Chapter 21 The Principle and Application of Common Used Techniques in Molecular Biology Explain the following terms1. probe2. PCR3. Gene diagnosis4. gene therapyDiscuss the following questions (Essay questions)1. Describe the definition, type and application of the blotting technique.2. Describe the PCR reaction principle and the basic steps.。

Abstract Genetic diversity among 115coffee accessions from the Coffea Germplasm Collection of IAC was assessed using SSR markers.The germplasm represents 73accessions of Coffea arabica derived from spontaneous and subspon-taneous plants in Ethiopia and Eritrea,species center of origin and diversity,13commercial cultivars of C.arabica developed by the Breeding Program of IAC,1accession of C.arabica cv.‘Geisha’,13accessions of C.arabica from Yemen,5accessions of C.eugenioides ,4accessions of C.racemosa and 6accessions of C.canephora .Genetic analysis was performed using average number of alleles per locus (A ),proportion of polymorphic loci (P ),Shannon’s genetic index (H ¢;and G ¢ST )and clustering analysis.All eval-uated species were distinguished by a cluster analysis based on Jaccard’s coefficient.Differen-tiation between the cultivated plants of C.arabica and accessions derived from spontaneous and sub-spontaneous plants was observed.Spontaneous and subspontaneous accessions from Ethiopia were separated according to the geographical origin:east and west of the Great Rift Valley.Cultivated plants showed a low genetic diversity with a division in two groups:accessions from Yemen (H ¢=0,028)and Brazilian commercial cultivars (H ¢=0,030).The results agreed with previously reported narrow genetic basis of cul-tivated plants of C.arabica and supported the hypotheses about domestication of the species.This study also showed a significant genetic diversity among accessions from Ethiopia and Eritrea present in the Germplasm Collection of IAC.This diversity is specially observed in accessions from Sidamo (H ¢=0,143),Kaffa (H ¢=0,142)and Illubabor (H ¢=0,147)indicating their importance as source of genetic variability for coffee breeding programs.Keywords Coffea arabica ÆDomestication ÆGermplasm ÆMolecular markersIntroductionAlthough the genus Coffea contains approxi-mately 80taxa (Bridson and Verdcourt,1988),only two species are commercially exploited,M.Silvestrini (&)ÆO.Guerreiro-Filho ÆM.B.SilvarollaCentro de Cafe´‘‘Alcides Carvalho’’,Instituto Agronoˆmico de Campinas (IAC),Campinas,SP 13001-970,Brazile-mail:milene.silvestrini@M.G.Junqueira ÆA.C.Favarin ÆC.A.ColomboCentro de Recursos Gene´ticos Vegetais,Instituto Agronoˆmico de Campinas (IAC),Campinas,Brazil M.P.MalufEmpresa Brasileira de Pesquisa Agropecua´ria (Embrapa),Campinas,BrazilGenet Resour Crop Evol (2007)54:1367–1379DOI 10.1007/s10722-006-9122-4RESEARCH ARTICLEGenetic diversity and structure of Ethiopian,Yemen and Brazilian C offea arabica L.accessions using microsatellites markersMilene Silvestrini ÆMichele G.Junqueira ÆAndre ´a C.Favarin ÆOliveiro Guerreiro-Filho ÆMirian P.Maluf ÆMaria B.Silvarolla ÆCarlos A.ColomboReceived:25November 2005/Accepted:12September 2006/Published online:28February 2007ÓSpringer Science+Business Media B.V.2007Coffea arabica L.and Coffea canephora Pierre ex Froehner.C.arabica is an autogamous species and the only allotetraploid(2n=4x=44)of the genus while the other species are diploids(2n=2x =22)and generally self-incompatible(Krug and Carvalho,1951). C.arabica is native of the highlands of Ethiopia(Sylvain,1955),but there are also records of wild arabica coffee in the Boma Plateau of Sudan(Thomas,1942)and Mount Marsabit of Kenya(Berthaud and Charrier,1988).The arabica coffee cultivation started in Arabia, specifically in Yemen,five centuries ago.In the early 18th century,progenies from a single Indonesia plant cultivated in Europe were spread out to South America and turned out to be the genetic basis of main cultivars of Brazil and other countries (Chevalier and Dagron,1928;Carvalho,1945).In view of this narrow genetic basis and the necessity of genetic resources conservation,FAO organized in1964–65a mission to collect sponta-neous and subspontaneous coffee germplasm in probable native regions of the species(FAO, 1968).This initiative resulted in621samples of seeds from various collecting sites in Ethiopia and the Republic of Eritrea which were carefully documented and sent to six institutions in India,Tanzania,Ethiopia,Costa Rica,Peru and Portugal for further research(FAO,1968).The accessions represented in the Coffee Germplasm Collection of Instituto Agronoˆmico de Campinas(IAC)include plant material orig-inated from308of those seed sample,obtained from plants of the Centro Agrono´mico Tropical de Investigacio´n y Ensen˜anza(CATIE)at Turri-alba,Costa Rica,collected in the years1973and 1987.There is also a substantial number of cultivated coffee germplasm in the IAC’s collec-tion.Besides this,several samples of plants from Yemen were introduced by A.B.Eskes,a researcher from IRCC,Montpellier,after a detailed morphologic and agronomic character-ization(Eskes and Mukred,1990).Since their introduction at IAC,all those materials are under continuous evaluation regard-ing botanic,agronomic,and technologic aspects (Carvalho et al.,1983;Mazzafera et al.,1990; Silvarolla et al.,2000).However,despite all these studies,the degree of genetic diversity and structure of the IAC collection is poorly under-stood.In order to fulfill this analysis,molecular markers could help reveal the structure of genetic diversity,which is an important information for setting up a core collection and to improve the conservation,accessibility and use of genetic resources of this collection(Hamon et al.,1999).Previous studies have already evaluated the genetic diversity of some Ethiopian and FAO accessions through morphologic and agronomic characteristics(Montagnon and Bouharmont, 1996),RAPD markers(Lashermes et al.,1996; Anthony et al.,2001;Chaparro et al.,2004;Aga et al.,2003)and ISSR markers(Aga et al.,2005). However,in these studies only few accessions from Yemen were analyzed(Montagnon and Bouharmont,1996;Lashermes et al.,1996; Anthony et al.,2002)and were reported different results regarding grouping and genetic structure of those accessions collected in different regions from Ethiopia and Yemen.Chaparro et al.(2004) did not found an association between grouping and the site of origin in Ethiopia.Montagnon and Bouharmont(1996)showed that there is a sepa-ration between coffee trees growing east and west of the Great Rift Valley,with accessions from south–eastern and southern of Ethiopia being grouped together with cultivated plants from Yemen.Anthony et al.(2001)and Aga et al. (2003,2005)also distinguished eastern and western groups in accessions from Ethiopia,but with a low genetic differentiation between them and cultivated plants arising as a group apart (Anthony et al.,2001).Microsatellites markers(SSR)have shown good efficiency to assess genetic diversity and relationships among coffee trees(Moncada and McCouch2004;Maluf et al.,2005).Thus,we thought SSR could be an alternative tool to elucidate the questions about genetic structure of C.arabica as well to characterize diversity levels of genetic resources included in the Coffea Germplasm Collection of IAC.Further-more,this is thefirst study analyzing a repre-sentative sample of both materials collected from the center of the origin and diversity of the C.arabica species and cultivated plants from Yemen and Brazil through microsatellites markers.Material and methods Plant materialThe evaluated plant material consisted of 115coffee accessions from the Coffea Germplasm Collection of IAC.These included 73accessions of C.arabica L.derived from spontaneous and subspontaneous trees from various regions of Ethiopia and Eritrea (Fig.1),13accessions of C.arabica from Yemen,1accession of C.arabica cv.‘Geisha’(Table 1),and 13commercial culti-vars of C.arabica developed by the IAC Breed-ing Program (Table 2).Also,5accessions of C.eugenioides S.Moore,4accessions of C.racemosa Lour.and 6accessions of Coffea canephora Pierre ex Froehner were included as outgroup species due to their importance in the evolutionary history of coffee and as source of target genes for breeding programs.Sampling of spontaneous and subspontaneous accessions from Ethiopia and Eritrea was representative of total accession number at the Germplasm Collection of IAC.Genomic DNA extractionTotal genomic DNA was extracted from frozen young leaves according to Stewart Jr.and Via (1993),using CTAB as detergent.All DNA samples were diluted to a final concentration of 20ng/l l.SSR amplificationPrimer sequences to amplify SSR locus were obtained from Combes et al.(2000)and Rovelli et al.(2000)(Table 3).Final reaction conditions were 40ng of genomic DNA, 1.5·reaction buffer,0.1mmol l –1of dNTP,2mmol l –1of MgCl 2,5q mol of each primer and 1.5U of Taq DNA polymerase.The complete thermal cycle program was 5min at 95°C,followed by 30cycles of 1min at 95°C,1min at 60°C and 1min at 72°C,and a final 5min of elongation time at 72°C.Primers were fluorescently labelled and ampli-fied products were separated on a 5%acrylamide gel using an ABI 377automatedsequencerFig.1Collecting sites of Coffea arabica accessions evaluated.Ethiopia political organization is according to FAO (1968),except by separation of Eritrea(Applied Biosystems).Products were detected by the applicative Gene Scan(Applied Biosys-tems)using internal molecular size markers (GENESCAN-500ROX),and analyzed by the applicative Genotyper v 2.0(Applied Biosys-tems).Table1List of Coffea arabica accessions from the Coffea Germplasm Collection of IAC analyzed through SSR markers.‘‘E’’identifies material collected in Ethiopia and Eritrea by FAO and‘‘T’’identifies material from the CATIE’s collection.Spontaneous(spont)and subspontaneous-derived(sub)material originated from single plant,random or representative sample according to FAO(1968)Origin SampleCode Accession CollectionnumberType Origin SampleCodeAccession CollectionnumberTypeHarar HA1IAC2026E12/T4950Random sample sub Kaffa KA23IAC3929E336/T4594Single sub HA2IAC2025E7/T4472Random sample sub KA24IAC3930E345/T4603Single subSidamo SI1IAC2029E18/T4474Random sample sub KA25IAC3948E142/T4663Single spont SI2IAC2102E237/T4758Representativesample subKA26IAC3949E143/t4664Single spontSI3IAC2032E22/T4476Random sample sub KA27IAC3952E468/T4691Single subSI4IAC2030E19/T4475Random sample sub KA28IAC3950E144/T4665Single spontSI5IAC2031E21/T4953Random sample sub KA29IAC3954E188/T4693Two plants sub SI6IAC2028E17/T4473Random sample sub KA30IAC3955E311/T4699Single subShoa SH1IAC2027E16/T4951Random sample sub KA31IAC3959E385/T4784Single sub SH2IAC2035E36/T4500Random sample sub KA32IAC3960E388/T4787Single subSH3IAC2036E37/T4501Random sample sub KA33IAC3965E396/T4803Single subEritrea ER IAC2207E579/T4945Random sample sub KA34IAC3968E411/T4811Single subGojjam GO1IAC2205E571/T4939Single sub KA35IAC3972E418/T4818Single sub GO2IAC2202E558/T4926Single sub Illubabor IL1IAC3986E453/T4853Single spontGO3IAC2206E572/T4940Single sub IL2IAC3985E448/T4848Single spontGO4IAC2204E565/T4933Single sub IL3IAC3984E446/T4846Single spontGO5IAC2203E563/T4931Single sub IL4IAC3983E445/T4845Single spontGO6IAC4008E559/T4927Single sub IL5IAC3981E438/T4838Single spontGO7IAC4009E560/T4928Single sub IL7IAC3979E436/T4836Single spontGO8IAC4010E561/T4929Single sub IL8IAC3976E425/T4825Single spontGO9IAC4011E562/T4930Single sub IL9IAC3975E424/T4824Single spontGO11IAC4013E578/T4944Single sub IL10IAC3843E431/T4831Single spontGO12IAC4015E577/T4959Single sub IL11IAC3849E465/T4865Single spontKaffa KA1IAC3814E134/T4568Random sample sub IL12IAC3934E358/T4631Single sub KA2IAC3818E328/T4586Single sub IL13IAC3935E361/T4634Single subKA3IAC3832E226/T4749Single sub IL14IAC3936E366/T4639Single subKA4IAC3856E531/T4900Single sub IL15IAC3937E367/T4640Single subKA5IAC3838E380/T4795Single sub IL16IAC3938E369/T4642Single subKA6IAC3995E522/T4889Single sub IL17IAC3940E373/T4646Single subKA7IAC3998E536/T4905Single subKA8IAC3999E539/T4908Single spont Geisha(cv)GE IAC2210T4305Cultivated fromMalawi KA9IAC4000E542/T4911Single sub Yemen YE1IAC4113Cultivated-Localtype KA10IAC4001E543/T4912Single sub YE2IAC4114Cultivated-Localtype KA11IAC4002E547/T4916Single sub YE4IAC4116Cultivated-Tessawi KA12IAC3804E307/T4485Single sub YE5IAC4117Cultivated-Tessawi KA13IAC3839E412/T4812Single sub YE6IAC4118Cultivated-Essaii KA14IAC3913E495/T4533Single sub YE8IAC4120Cultivated-Essaii KA15IAC3915E300/T4546Single sub YE10IAC4122Cultivated-Tessawi KA16IAC3916E474/T4547Single sub YE11IAC4123Cultivated-Odaynii KA17IAC3917E475/T4548Single sub YE12IAC4124Cultivated-Localvariant KA18IAC3919E480/T4553Single sub YE13IAC4125Cultivated-Localvariant KA19IAC3920E488/T4560Single sub YE14IAC4126Cultivated-Tessawi KA20IAC3921E491/T4564Single sub YE15IAC4127Cultivated-Katii KA22IAC3926E150/T4573Single sub YE16IAC4128Cultivated-KatiiTable2List of commercial Coffea arabica cultivars developed by IAC evaluated through SSR markersCultivar Sample code OriginAcaia´IAC474-4AC474-4Bourbon Vermelho·Sumatra(Typica)Mundo Novo IAC388-17MN388-17Bourbon Vermelho·Sumatra(Typica)Bourbon Amarelo IAC J19BA Bourbon Vermelho(mutation)Catuaı´Vermelho IAC81CV81Caturra Amarelo476·Mundo Novo374-19Catuaı´Vermelho IAC144CV144Caturra Amarelo476·Mundo Novo374-19Catuaı´Amarelo IAC100CA100Caturra Amarelo476·Mundo Novo374-19Icatu Vermelho IAC4042IV4042(C.canephora cv.Robusta·Bourbon Vermelho)·Mundo Novo Icatu Vermelho IAC4045IV4045(C.canephora cv.Robusta·Bourbon Vermelho)·Mundo Novo Icatu Vermelho IAC4046IV4046(C.canephora cv.Robusta·Bourbon Vermelho)·Mundo Novo Icatu Amarelo IAC2944IA Icatu Vermelho·Bourbon AmareloOuro Verde IAC H5010-5OV Catuaı´Amarelo·Mundo Novo515Obata˜IAC1669-20OB(Villa Sarchi·Hybrid of Timor)·Catuaı´VermelhoTupi IAC1669-33TP(Villa Sarchi·Hybrid of Timor)·Catuaı´VermelhoTable3Access number of microsatellite loci in the‘‘Genbank’’,locus code and respective forward(F)and reverse(R) primer sequencesAcession number Locus code Sequence of primers(5‘–3’)Repeated sequenceAJ3087384-1CTG F=AAAAAGCTGGTCCATGTCAA(TG)8(SSR5)R=GGGGCGTTCAGTTATAAACAAJ30874617-2CTG F=AGGCCTTCATCTCAAAAACC(TC)14/(CA)11/(CA)16(SSR6)R=AGCGTTACTTGAGGCAAAGAAJ308762E6-3CTG F=CTGGGTTGGTTCTGATTTTG(TG)16(SSR7)R=GGTTCCCAGAGATTCTCTCCAJ308767E12-3CTG F=TGCTTAGGCACTTGATATAGGA(CA+TA)38(SSR9)R=CACGTGCAAGTCACATACTTTAAJ308785I9-3CTG F=TGGCCGTGATAATAAACAGC(TG)21(SSR11)R=ATGTGGCAATCTAAAGCCAAAJ250258M32F=AACTCTCCATTCCCGCATTC(CA)3/(CA)3/(CA)18(SSR14)R=CTGGGTTTTCTGTGTTCTCG–C2-2CATC F=CTCTCCCTCAGTCAATTCCA(ATC)14(SSR15)R=CTTGGTCTCCCTCCTTTTTCAJ30875432-2CTG F=AAGGGGAGTGGATAAGAAGG(CA)12(SSR17)R=GGCTGGATTTGTGCTTTAAGAJ308764E8-3CTG F=CACTGGCATTAGAAAGCACC(CA)14(SSR18)R=GGCAAAGTCAATGATGACTCAJ250251M3F=ATTCTCTCCCCCTCTCTGC(CA)6/(CA)3/(CA)3/(CA)3/ (SSR20)R=TGTGTGCGCGTTTTCTTG(CA)4/(CA)3/(CA)3/(CA)3AJ250252M11F=ACCCGAAAGAAAGAACCAAG(GT)4/(GA)4/(GT)4/(GT)6 (SSR21)R=CCACACAACTCTCCTCATTCAJ250253M20F=CTTGTTTGAGTCTGTCGCTG(GA)5/(GT)8/TT(GT)4/TT (SSR22)R=TTTCCCTCCCAATGTCTGTA(GT)7/(GA)11/(TC)2/(CT)3GT AJ250255M25F=CCCTCCCTGCCAGAAGAAGC(GT)5/CT(GT)2/(GT)12(SSR24)R=AACCACCGTCCTTTTCCTCGAJ250256M27F=AGGAGGGAGGTGTGGGTGAAG(GT)11(SSR25)R=AGGGGAGTGGATAAGAAGGAJ250257M29F=GACCATTACATTTCACACAC(CTCACA)4/(CA)9(SSR26)R=GCATTTTGTTGCACACTGTAAJ250260M47F=TGATGGACAGGAGTTGATGG(CT)9/(CA)8/(CT)4/(CA)5 (SSR27)R=TGCCAATCTACCTACCCCTTData analysisGels were scored by presence or absence of bands or alleles.Due to the tetraploid condition of C.arabica,it is impossible to distinguish between diallelic duplex and simplex and among different types of triallelic combinations of SSR loci. Therefore,for each individual plant,fragment frequencies were analyzed as multilocusfinger-prints,in which each allele was either scored present or absent.Genetic diversity within groups of C.arabica and within diploids species was evaluated by average number of alleles per locus(A),propor-tion of polymorphic loci(P)and the Shannon’s genetic index(H¢)(Bussel,1999).Groups of C.arabica consisted of accessions of the same collecting region(Table1)and commercial culti-vars developed by IAC.Cultivar‘Geisha’was excluded of the genetic diversity analysis because it was represented by only one accession/group. Estimation of A was an exception to the multilo-cusfingerprints approach once amplified products of each pair of primers were considered as alleles of the same locus.P was calculated dividing the number of polymorphic bands by total number of amplified bands in each group.Shannon’s genetic index for each marker was calculated for each group as:H¢=-Pp i*log2p iwhere p i is the frequency of the presence or absence of a band in that group.Following the method of Bussel(1999),the partitioning of genetic variation within and between groups of C.arabica was estimated.The average diversity over all populations for each locus(H¢pop)and the total diversity in the99 accessions of C.arabica for each locus(H¢sp)were calculated(for more details see Bussel,1999).Then the component of diversity within populations (H¢pop/H¢sp)and the component between popula-tions(G’ST=(H¢sp–H¢pop)/H¢sp)were estimated.H¢,H¢pop,H¢sp and G¢ST were the average values per locus calculated over all loci,including monomorphic ones,according to Bussel(1999). We categorized the partitioning of genetic diver-sity analysis according to the groups of accessions analyzed.These groups included all accessions (Analysis1),all accessions without Eritrea group (Analysis2),spontaneous and subspontaneous accessions(Analysis3)and spontaneous and subspontaneous accessions without Eritrea group (Analysis4).Eritrea group was excluded from Analysis2and4to improve understanding of species genetic structure.This was carried out because Eritrea group contains just one individual and this could lead to bias G¢ST values by decreasing H¢pop.Genetic distance among all accessions(includ-ing C.arabica cv.‘Geisha’)was estimated as the complement of Jaccard’s(1908)coefficient(Link et al.,1995).Genetic distances were also esti-mated using Dice coefficient(Dice,1945),which is equivalent to Nei and Li(1979),in order to compare values with other studies.Cluster anal-ysis was performed using the matrix distance based on the complement of Jaccard’s coefficient employing the UPGMA method.Bootstrap anal-ysis(Felsenstein,1985)was performed to evalu-ate the tree topology reliability for1,000 simulations using the software Treecon(Van de Peer and Watcher,1994).ResultsThe multilocusfingerprints approach was used to analyze the genetic diversity and structure of coffee accessions.In spite of this,specific results for each primers pairs were pointed out for characterization of individual SSR locus.SSR locus characterizationThe E12-3CTG(SSR9)locus showed a profile with3and4peaks even in diploid species such as C.canephora and C.eugenioides.The 4-1CTG(SSR5)locus was monomorphic(band of97bp)in C.arabica and C.eugenioides and did not amplify any fragment in C.racemosa and C.canephora species.Primers E6-3CTG, E8-3CTG and M3also amplified monomorphic bands within C.arabica accessions(a total of12 bands),and those were polymorphic among evaluated species.Genetic diversitySixteen SSR primers pairs produced a total of121 bands or alleles.All tested markers detected polymorphisms among the accessions evaluated, being54bands among C.arabica accessions and15bands among cultivated plants(Yemen,‘Geisha’and Brazilian cultivars).Also,7out of54 polymorphic bands of C.arabica,were present at high frequencies(0.8or more),31as rare alleles in low frequency(0.2or less)and16with frequencies between0.2and0.8.Genetic diversity analysis showed the highest values of H¢in diploid species(Table4).Values for A in diploid species were similar or even lower than those observed in C.arabica groups,prob-ably due to the allotetraploid nature of C.arabica which results in duplicate A values per plant.H¢values were relatively high in accessions from Kaffa,Illubabor and Sidamo provinces,moderate in Gojjam and Harar,and very low in cultivated plants.The P index was higher in diploid species and within Kaffa and Illubabor groups.The discrepancy of H¢relative to A and P values in Kaffa and Illubabor groups occurred due to the presence of rare alleles(Table4).Genetic distances ranged from0to0.88 between all possible pairs of genotypes,from0 to0.37among C.arabica accessions,from0to 0.30among spontaneous and subspontaneous accessions from Ethiopia and Eritrea,and from 0to0.19among cultivated accessions(Fig.1). Genetic distances among C.arabica accessions were also calculated using only the polymorphic bands exclusive to C.arabica(44.6%of total fragments).Results showed that this distance ranged from0to0.65using Jaccard’s coefficient or its complement and from0to0.49using Dice’s coefficient.Genetic structureG¢ST values showed a strong genetic structure in all accessions of C.arabica(Table5).A strong genetic structure was also observed in spontane-ous and subspontaneous accessions from Ethio-pian.Exclusion of group Eritrea,which contains just one individual,increased H¢pop values and decreased G¢ST values but yet results showed the strong genetic structure in the evaluated acces-sions(Table5).The hierarchical clustering analysis presented in Fig.2showed four major clusters comprising grouped accessions of each species.The analysis of species relationships showed C.canephora closer to C.arabica,followed by C.eugenioides. Also, C.racemosa was distantly related to C.arabica.Grouping of C.arabica accessions(Fig.2) revealed two main clusters.Thefirst contains only cultivated plants,including the accessions of Yemen,cultivar‘Geisha’and commercial cultivars from Brazil.An exception was the accession of Sidamo(SI4)also included in this group with materials from Yemen.Yemen accessions of type Tessawi(Table1)were distinguished from the others in a separated cluster.The second group encompassed basically all spontaneous and sub-spontaneous accessions from Ethiopia and Eri-trea.Despite the low boostrap values(Fig.2), there was a clear separation of these accessions in two large subgroups:thefirst included mainlyTable4Genetic diversity within species and groups of coffee species assessed by average number of alleles per locus(A),proportion of polymorphic loci(P) and Shannon’s genetic index averaged over all loci(H¢)Species Group A P(%)H¢Coffea arabica Harar(HA) 2.3 5.00.050Sidamo(SI) 2.716.50.143Shoa(SH) 2.512.40.115Eritrea(ER) 2.0––Gojjam(GO) 2.513.20.087Kaffa(KA) 3.224.80.142Illubabor(IL) 3.124.00.147Yemen(YE) 2.2 5.00.028Commercial cultivars 2.0 4.10.030 Coffea eugenioides 2.529.80.242 Coffea canephora 2.824.60.197 Coffea racemosa 2.120.70.200accessions from Sidamo and the second subgroup included all other accessions from the west side of the Great Rift Valley.DiscussionSSR locus characterizationIn general,the amplification patterns for each SSR locus evaluated corresponded to those pre-viously reported.The profile of E12-3CTG (SSR9)locus with3and4peaks in the diploid species C.canephora and C.eugenioides con-firmed that this pair of primers amplified a number of independent loci(Rovelli et al., 2000).Considering this,E12-3CTG locus has not been used to estimate number of alleles per locus(A).The locus4-1CTG(SSR5)was monomorphic in C.arabica and C.eugenioides and did not amplify any fragment in C.racemosa and C. canephora species.According Rovelli et al.(2000) this locus showed diploid type segregation in C. arabica.Thus,it is probable that the amplification has just occurred in putative genome provided by C.eugenioides(Lashermes et al.,1999).However, in other analysis Poncet et al.(2004)using different primer sequences to amplify this same SSR locus identified a monomorphic band of 239bp also in C.canephora and other diploid species,including C.eugenioides.This new primer pair amplified the total SSR sequence present at GENBANK,while Rovelli et al.(2000)’s primers amplified only part of the SSR sequence.These results suggested that the4-1CTG locus is present in C.arabica, C.eugenioides and C.canephora and other Coffea species(see Poncet et al.,2004).However,there is an interspecific polymorphism in theflanking regions of SSR that prevent amplification in C.canepho-ra,C.racemosa and in the putative C.canephora genome of C.arabica(Lashermes et al.,1999). Interestingly,Rovelli et al.(2000)identified heterozygotes in the accessions of C.arabica var.Caturra showing a polymorphism in repeat motifs within cultivated plants of C.arabica that was not observed in our study.Genetic diversityThe high variability detected in spontaneous and subspontaneous accessions of C.arabica was observed mainly in coffee trees from Sidamo, Kaffa and Illubabor provinces although it also must be noted that50%of accessions were sampled from Kaffa and Illubabor regions. Significant levels of genetic diversity in coffee plants from Kaffa and Illubabor were also reported by Anthony et al.(2001)and Chaparro et al.(2004).Indeed,the high variability among accessions from these regions in the collections is a consequence of the great effort in collecting samples with as much visual,botanical and agronomical diversity as possible(FAO,1968). The high genetic diversity detected in Sidamo accessions could be visualized by the proportion of shared alleles among genotypes within both divergent groups of C.arabica,cultivated plants and spontaneous and subspontaneous accessions from Ethiopia.Comparing the genetic distance values among C.arabica accessions,we found values similar to those reported by Orozco-Castillo et al.(1994), Anthony et al.(2001,2002),but lower values than Moncada and McCouch(2004).Genetic diversity evaluated by allele distribution(29.6%of alleles Fig.2Dendrogram of the115Coffea accessions listed in Tables1and2based on Jaccard genetic distance obtained from SSR markers using the UPGMA method.Numbers (%)on the branches correspond to bootstrap values above 50%(1,000replications).Letters indicate the geographical origin of accessions:W(West of the Great Rift Valley) and E(East of the Great Rift Valley)cTable5Partitioning of genetic diversity generated by121 SSR bands within and between groups of Coffea arabica accessions.H¢pop,H¢sp and G¢ST are the average per locus values allGroups analyzed H¢pop H¢sp G¢ST(1)All accessions0.0820.2100.577(2)All accessions without Eritrea0.0930.2100.526(3)Spontaneous and subspontaneousaccessions0.0980.1790.464 (4)Spontaneous and subspontaneousaccessions without Eritrea0.1140.1750.349with frequencies between0.2and0.8)revealed a diversity degree intermediate between that iden-tified by Anthony et al.(2001)and that found by Chaparro et al.(2004),with17and39.6%of alleles with frequencies between0.2and0.8, respectively.Proportion of polymorphic loci and Shannon’s index values estimated in this study can be considered in the same range of a similar analysis of arabica coffee in natural populations from Ethiopia(Aga et al.,2003).These authors determined P and H¢values ranging from37% to73%and0.2to0.4,respectively,in9plants per population.However,P and H¢were calcu-lated based on C.arabica amplified bands while in the present study all amplified bands,includ-ing those specific of diploid species and mono-morphic to C.arabica were included in the index calculation.On the other hand,if only C.arabica amplified bands were considered for calculating P and H¢values,these would be for Kaffa group,for example,P=55.6%and H¢= 0.328,identical to that observed by Aga et al. (2003).Besides this,observed values of genetic distances among accessions were similar in both studies.Therefore,these results suggest that there is a significant genetic diversity in the coffee collec-tion of IAC.Furthermore,the genetic diversity estimated for Ethiopian accessions was higher than that of cultivated plants.Thus there is a large variation that can be source for introgression of desirable characteristics in commercial cultivars that has already been used by the coffee breeding program of IAC(Bettencourt and Carvalho, 1968;Moraes et al.,1974;Fazuoli,1981;Silvarolla et al.,2004).Genetic structureResults of amplification of4-1CTG locus in C.arabica,C.eugenioides and C.canephora and analysis of species relationship observed in this work are in agreement with the hypothesis about the botanic origin of C.arabica species as a natural hybrid between C.canephora and C.eugenioides(Lashermes et al.,1999).Despite contrasting results concerning which of both species is closer to C.arabica,several molecular markers as well as phylogenetics studies have recognized C.canephora and C.eugenioides closer related to C.arabica than other Coffea species(Lashermes et al.,1993,1997;Cros et al., 1998;Ruas et al.,2000,2003).These diversity analyses also identified C.racemosa as the most genetically distant species of C.arabica.According to Bussel(1999)calculation of G’ST using the Shannon’s index are in accordance with G ST estimated by other methods,such as AMOVA and modified F-statistics.Also,G’ST is a good estimate to evaluate genetic structure of tetraploid,autogamous collections such as this of C.arabica plants,where heterozygosity cannot be assessed and Hardy–Weinberg equilibrium assumptions cannot be considered.G’ST values of C.arabica observed in this workfitted into expected values based on the breeding system.In that case,according to Bussel(1999),G’ST values for autogamous species from natural populations is around60%and around15%for allogamous species.Results of G¢ST for C.arabica accessions associated with cluster analysis indicated a strong genetic structure in the species.Therefore,the genetic diversity was observed among groups rather than within groups.Cluster analysis clearly showed the separation of cultivated plants from Ethiopian and Eritrean spontaneous and sub-spontaneous accessions.Besides,the analysis allowed distinguishing a morphologic type of Yemen(Tessawi)and Yemen accessions from Brazilian cultivars,although both groups exhib-ited a very low genetic diversity.These results are in agreement with the well-described narrow genetic basis of cultivated plants of C.arabica (Lashermes et al.,1996;Anthony et al.,2001; Moncada and McCouch2004;Maluf et al.,2005) and historical data.Brazilian coffee originated from a few plants introduced in the early18th century and these plants were originated from the first cultivated plants in Yemen(Chevalier and Dagron,1928;Carvalho,1945).Partitioning of genetic diversity of the sponta-neous and subspontaneous accessions showed a lower value of G¢ST(0.464)than that observed when all accessions were analyzed.However,the G¢ST value still indicated a strong genetic struc-ture in these accessions.Hence,accessions of。