Blockade of Angio-Associated Migratory Cell Protein Inhibits Smooth Muscle Cell Migration and

www.100biotech.com

service@100biotech.com Online Appendix for the following July 22 JACC article TITLE: Blockade of Angio-Associated Migratory Cell Protein Inhibits Smooth Muscle Cell Migration and Neointima Formation in Accelerated Atherosclerosis AUTHORS: Felix Vogt, MD, Alma Zernecke, MD, Marie Beckner, PHD, Nicole Krott, MSC, Anja-Katrin Bosserhoff, PHD, Rainer Hoffmann, MD, Marc AMJ Zandvoort,PHD, Thomas Jahnke, MD, Malte Kelm, MD, Christian Weber, MD, Rüdiger Blindt, MD APPENDIX Materials and Methods Online Supplement: Culture of Smooth Muscle Cells Medial rat smooth muscle cells (rSMCs) were isolated from the medial layer of the thoracic aorta of 6-week-old male Sprague-Dawley rats; neointimal rSMCs were derived from the neointimal thickening of the aorta 2 weeks after balloon angioplasty by microscopic dissection (1). Human smooth muscle cells (hSMCs) were isolated from the medial layer of mammary arteries after coronary artery bypass operation as described (2); informed written consent of all patients was obtained before the procedure. The rSMCs and hSMCs were grown in Dulbecco’s modified Eagle’s medium (DMEM/Nut.Mix F-12 with Glutamax; Gibco-BRL, Gaithersburg, Maryland) supplemented with penicillin (100 U/ml), streptomycin (10 μg/ml) (both Sigma-Aldrich, St. Louis, Missouri) and 10% heat-inactivated fetal calf serum (FCS; Gibco-BRL). Cells were used between passages 3 and 7. The characteristic hill-and-valley growth pattern as well as strong immunostaining for alpha-smooth muscle actin (alpha-SMA) but not von

www.100biotech.com

service@100biotech.com Willebrand factor (vWF) confirmed the smooth muscle cell phenotype of isolated and cultured cells with a purity of >95%. Sparse-grown SMCs were split 2 days before each assay. Dense-grown cells were maintained at confluency for at least 5 days before each assay and were serum-starved for 72 h. The SMCs were tested for their migratory potential with a transwell migration chamber system as described (2). Only SMCs with a distinct migratory phenotype were used for migration experiments; dense-grown SMCs, characterized by a significantly lower migratory potential, served as negative control. Quantitative Western blotting. For Western blotting of cultured SMCs, cells were suspended in radio-immunoprecipitation assay (RIPA) buffer (Roche, Mannheim, Germany); for analysis of SMC supernatants, concentration of supernatants was performed by freeze drying (Christ Alpha 2-4, Braun Biotech Int., Melsungen, Germany) before Western blotting. For in vivo expression analysis, porcine coronary arteries were prepared as described (3). Briefly, the vascular segments were sliced longitudinally, the medial and neointimal tissue was carefully separated from the adventitia, and the obtained vascular tissue was homogenized and suspended in RIPA buffer. Undilated arteries (n = 4) and balloon-injured arteries at 1 week (n = 4) and at 4 weeks (n = 4) were investigated. Always, 15 µg of protein was separated by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (Novex, San Diego, California) and subsequently blotted onto a polyvinylidene fluoride membrane. After blocking for 1 h with 3% bovine serum albumin–phosphate buffered saline, membranes were incubated with anti-recombinant angio-associated migratory cell protein antibody (anti-rAAMP-ab) (1:1000, 2 h), washed, and incubated with the secondary antibody. For detection, nitro blue tetrazolium (NBT)-5-bromo-4-chloro-3-indolyl phosphate (BCIP) staining (Sigma-Aldrich) was used. Equal loading of Western blots was assured by quantification of total protein content before each experiment (BCA Protein Assay Kit, Pierce,

www.100biotech.com

service@100biotech.com Rockford, Illinois) and by assessment of beta-actin expression. Blotted membranes were quantified with “ImageJ” image processing software (4). Subcellular fractioning and RhoA and RAC activity assays. To explore differential AAMP and RhoA localization by subcellular fractioning, a proteome extraction kit (Merck Chemicals, Nottingham, United Kingdom) was applied as described by the manufacturer. Membrane fractions that contain activated GTP-bound RhoA and cytosolic fractions that contain inactive GDP-bound RhoA were analyzed by Western blotting. Typically, 10 µg of protein was analyzed, representing 1% to 2% of the cytosolic fraction and 10% to 20% of the membrane fraction. For RAC analysis, a RAC activation assay kit (Upstate, Lake Placid, New York) was applied according to the manufacturer’s instructions. Transient transfection of AAMP vector constructs and small interfering ribonucleic acid. The coding region of the human AAMP gene was polymerase-chain reaction–amplified with the following primers: AAMP forward 5` GACGAATTCATGGACTCTGGGAGGCGTTTG 3` and AAMP reverse 5` GACGAATTCCCATTAACGGTCAGGCCTTTG 3`; primer annealing temperature 62°C. After control nucleotide sequencing with additional primers binding to overlapping regions of the AAMP gene (AAMP forward 2 [5` CCTTGGCAGTGACCGGGGG 3`] and AAMP reverse 2 [5` GGCTGGGCTGGGAGGCCAC 3`]), AAMP complementary deoxyribonucleic acid was inserted into the vector pCMX-GL1 via EcoRI restriction sites. Mock and GFP vectors were used as controls. To induce AAMP knockdown in SMCs, small interfering ribonucleic acid (siRNA) was used. The AAMP siRNA, lamin controls, and fluo duplex transfection efficacy controls were purchased from Dharmacon (Lafayette, Colorado).