下载文档原格式
工作总结(英文版)W o r kR e p o r t-标准化文件发布号：（9556-EUATWK-MWUB-WUNN-INNUL-DDQTY-KIIWork ReportTime flies. I have been here for more than four months. Those days must be the most precious time in my life. Although I did nothing remarkable, it was still an unusual experience and treasure to me. During the four moths, whether at work or in life, the kindness leaders and warmhearted colleagues gave me a great help. It is my honor to being in this harmonious atmosphere. I feel so happy. With the help of all the above persons and my own effort, I have made a certain amount of progress in all aspects. As following:1. General information of the company that I have acquaintanceI have got a detailed information of our company and the entire field through my accumulated experience of daily work and training. The aim of our company is to organize Chinese delegations abroad for training, visiting, cultural exchange and international experience communication. It becomes a professional institute with its own powerful strength and quality of service through the past years’ effort. It has successfully made a lot of international cooperative projects and built a good relationship with many foreign organizations. The status and business situation of our company make me full of hope for the development of both the company and myself in the future.2.Abide the rules and regulations to work hard and seriously to improve my quality and ability constantly.Experiencing more than four months training, and with my great love and fervor, I can say without modesty that I have been strictly abide every piece of rules and regulations to work diligently and to complete the task seriously. More than four months, I have been keeping on arriving 20-30 minutes ahead of the working time every day and never late. Sometimes, in order to finish the work, I arrived at the company 1 or 2 hours earlier than usual. I believe no pains, no gains. I will try my best all the time.3. The great effort to study making my ability improved.According the current divide of the job, as the reception and assistant of the operation department, my job is to charging for the reception work, assist with somedaily administrative and operations of the operation department. My daily work mainly includes telephone picking up, various types of mail, fax receiving, courier of the reception, text-dealing, water ordering and so on. Thus, I have already acquired the knowledge of some operation work and my ability has improved a lot. Such as the make visa appointment, fill visa forms, write the invoices, select the international conferences in the English website, write the conference information and schedules etc. As a new person of this field, I have known a lot of things than before during these days, but I still need to keep on study every day and learn from every person of our company.4. Inadequate of myself and something need to improveAlthough I have been here for more than four months, I clearly know that my awareness the working system is not very exact. In order to further familiarize with the company and daily work of the operation department, I hope I can have the opportunity to do some operation work. I think doing more work can achieve my own life value.5. Some suggestionsThe development of the company needs not only the hard-working persons with ability, but also a sound management system, a clear duty dividing and so on. So, I think the company should pay attention to the most important way to cultivate talent is to through various effective methods to stimulate the enthusiasm of the staffs.。
Wang, Yunhan’s work report(under guidance of Qian)from Jul 14 to Sep 16 (9 weeks)1.My main project on TRAF5 protein1~4weeks: try to get hTRAF5 constructsI made an alignment between hTRAF6 and hTRAF5 and designed 7 primers(2 for, 5 rev) for 10fragment s of hTRAF5' N-term. The regular pcr with 58 degree annealing temperature hardly get enough products, so I tried gradient and touch down, but they were not helpful. Finally Qian and I focused the problem on cDNA sequence, and got sure that the cDNA is mouse's by sending the only two constructs I've got to sequence. (I should make sure all the basic materials are right on the original start , though this time it is a bit different 'coz Qian and Miao have got C-term hTRAF5 using this cDNA, and I have no primer binding well enough to it to directly sequence the cDNA.)5week: get mTRAF5 with C-term His-Tagit delayed for some time as the vector pET22b ligated itself seriously, finally I got 10 constructs. (I should make clear which step is important and which is not. As in this case to make new pET22b is better than just trying ligation and checking insert, etc.)6~7weeks: mTRAF5 protein expression and purification by gelfitritionsmall scale shows constructs express well in BL21CPDE3 R1DL, while in large scale(2L cells) gelfitrition results shows little proteins. I run SDS-PAGE and found[proteins are mostly in cell pellet, they are unsoluble.in 8~9 weeks Qian and I selected 2 constructs trying to get proteins individually, but still get the same negative results.8~9weeks: try to get mTRAF5 proteins with N-term GST-Tag or N-term His-Taggot 7 constructs of mTRAF5-pGEX-6P-1, but failed to insert pcr products into pET-28a. (I've tried several ways, such as changing ligation ratio, redigest vector etc. time was limited, so I had to give it up.) small scale shows the constructs express well, then I select 3 constructs(M1Y191, L25Y191, L25L252) which expressed better in small scale and do large scale(1L cell), then run gelfitrition to purify them.proteins' solubility increases much, though still have a lot in cell pellet. Proteins are unstable and precipitate possibly because concentration is too high. Gelfitrition shows M1Y191 and L25Y191 mostly exist as dimers even multimers. L25L252 is monomer, while SDS-PAGE has several bands below the right size, which might be other Ecoli protein or is degradation of L25L252. (I got gelfitrition result the day before I leave and discussed with Qian. If I have more time: (1). try to detect induction of mTRAF5 in different hours. I've induced cells for 16h, and the proteins are too much as they precipitate. Maybe reduce the hours of induction could also help solubility of the proteins. (2). try the N-term His-tag constructs. (3). collect proteins after gelfitrition and try to crystalize them or cut off the GST-tag( thus we should make some PreScission™ Protease first) and crystalize. (4). it is unclear what are bands below L25L252, one way is to sequence the proteins, and the other way is first use PreScission to cut off GST and see if these bands shift.)2.other proteins I've worked with3~4weeks: help Qian to express some proteins and purify them by gelfitritionincluding mutants of hTRAF6 and some complexs.7week: Ubc13/Uev1A/hTRAF6 complexOur initial plan is to get complex of E2 and E3, then try to cystalize it. Finally I got Ubc13/Uev1A complex, but cannot express hTRAF6 RZ1, RZ2, RZ4 in BL21CPDE3 R1DL. Then I have to stop it.(hTRAF6 is indeed expressed, but little. I repeated the experiments seriously from picking up colony but still failed. Maybe there is something wrong when doing tranformation.)3.simple crystallization9week: set up trays of TRAF6TIFA(C‐terminal), the complex I repurified and TRAF6 coiled‐coil region Qianhas crystalized already.I've just tr ied kits Wizard I & II, the com plex has no cystal, while beautiful crystals grow in TRAF6 protein, that is the same result with Qian.the last day: Qian taught me some basic knowledge on crystal structure.Appendix:1.protein properties:mTRAF5 fragments protein size nucleotide PI mTRAF5 fragments protein size nucleotide PI M1-Q135 15,552 kD 405 bp 6.43L25-Q135 13,022 kD 330 bp 6.69M1-R164 18,944 kD 492 bp 7.07L25-R164 16,414 kD 417 bp 7.62M1-Y191 22,126 kD 573 bp 6.35L25-Y191 19,596 kD 498 bp 6.52M1-A218 25,099 kD 654 bp 6.58L25-A218 22,569 kD 579 bp 6.83M1-L252 29,019 kD 756 bp 6.69L25-L252 26,489 kD 681 bp 6.92all the above C-terminal His-Tag proteins are hardly soluble. However, N-terminal GST-tag increases solubility of mTRAF5 M1Y191/L25Y191/L25L252(I have no time left to try other constructs and N-terminalHis-tag), in which M1Y191 and L25Y191 mainly forms dimer and multimer, but still, they are not very stabilized.2.list of vectors, primers and constructs I’ve made (all I’ve left with Qian):1).Vectors:pET-22b, pET-28a, pGEX-6P-1;Double enzyme digested:pET-22b(NdeI/XhoI), pET-22b(EcoRI/HindIII), pET-28a(EcoRI/XhoI), pGEX-6P-1(EcoRI/XhoI)2). mTRAF5 DNA fragments:M1Q135, M1R164, M1Y191, M1A218, M1L252, L25Q135, L25R164, L25Y191, L25A218, L25L252, all digested with EcoRI&HindIII, and can be insert into pET-22b;M1Q135, M1R164, M1Y191, M1A218, M1L252, L25Q135, L25R164, L25Y191, L25A218, L25L252, all digested with EcoRI&XhoI, and can be insert into pGEX-6P-1 or pET-28a.3). constructs of mTRAF5:C-terminal His-Tag:M1Q135-pET22b, M1R164-pET22b, M1Y191-pET22b, M1A218-pET22b, M1L252-pET22b, L25Q135-pET22b, L25R164-pET22b, L25Y191-pET22b, L25A218-pET22b, L25L252-pET22b;N-terminal GST-Tag:M1Q135-pGEX-6P-1, M1R164-pGEX-6P-1, M1Y191-pGEX-6P-1, M1L252-pGEX-6P-1, L25Q135-pGEX-6P-1, L25R164-pGEX-6P-1, L25Y191-pGEX-6P-1, L25L252-pGEX-6P-14). primers:hTRAF5label name sequenceforwyh01 GCGTCGCATATGGCTTATTCAGAAGAGCATAA M1 NdeI5’forwyh02 GCAGGTCATATGTTGGACTTTGAGCCCAGTAT L25 NdeI 5’revwyh03 GGTCTCGAGTTGAAATAAGCACTGCTGAAGG3’Q135XhoI3’revwyh04 CCGCTCGAGTCGAAACTGACAGGATGCAC R164XhoIwyh05 GCTCTCGAGGTATTCAGGACACAAGTTTTCCT Y191XhoI 3’ revrevwyh06 CCACTCGAGAGCTTCAGGACATACAGCCA A218XhoI3’rev3’wyh07 CATCTCGAGCAAACGCATGTGCTCCCGTAL252XhoImTraf5(to insert in pet22b(C-Term His))label name sequencefor5’1-M1F GTAGAATTCAATGGCTCATTCGGAGGAGCAAGC M1 EcoRIfor2-L25F* CTAGAATTCCTTGGACTTTGAGCCCGACAC L25 EcoRI 5’3-Q135R GCGAAGCTTTTGGAAGGAACAGTGCTGAAGGT Q135HindIII 3’revrev4-R164R GCTAAGCTTTCGGAACCGGCAGTATGCG R164HindIII 3’5-Y191R GCTAAGCTTGTACGCAGGACACGAGTTTTC Y191HindIII 3’ revrev6-A218R CCCAAGCTTAGCCTCAGGACATACAGTAAGGT A218HindIII 3’rev7-L252R GTTAAGCTTCAGAAGCATGTGGTCCTGCAG L252HindIII 3’*2-L25F is lack of ATG. But as it is inframe with pet22b and the vector has an ATG right before the sequence, so the protein could express.mTraf5(5’ inframe with pET-28a\pGEX-6P-1, 3’ has stop codon)label name sequencefor01-M1F CCGGAATTCATGGCTCATTCGGAGGAGCAAGC M1 EcoRI 5’for02-L25F CCGGAATTCTTGGACTTTGAGCCCGACAC L25 EcoRI 5’rev03-Q135R GCTCTCGAGGATTTGGAAGGAACAGTGCTGAAGGT Q135XhoI 3’rev04-R164R CCGCTCGAGGATTCGGAACCGGCAGTATGCG R164XhoI3’rev05-Y191R CCGCTCGAGGATGTACGCAGGACACGAGTTTTC Y191XhoI 3’06-A218R CCGCTCGAGGATAGCCTCAGGACATACAGTAAGGT A218XhoI 3’ rev07-L252R CCGCTCGAGGATCAGAAGCATGTGGTCCTGCAG L252XhoI 3’ rev。
