miRNA检测最快最简单的非同位素最新方法

This article appeared in a journal published by Elsevier.The attached copy is furnished to the author for internal non-commercial research and education use,including for instruction at the authors institutionand sharing with colleagues.Other uses,including reproduction and distribution,or selling or licensing copies,or posting to personal,institutional or third partywebsites are prohibited.In most cases authors are permitted to post their version of thearticle(e.g.in Word or Tex form)to their personal website orinstitutional repository.Authors requiring further informationregarding Elsevier’s archiving and manuscript policies areencouraged to visit:/copyrightDetecting miRNAs by liquid hybridization and color developmentXiangqi Li a ,b ,⇑,Minjie Ni a ,Yonglian Zhang a ,b ,⇑aShanghai Key Laboratory for Molecular Andrology,State Key Laboratory of Molecular Biology,Institute of Biochemistry and Cell Biology,Shanghai Institutes for Biological Sciences,Shanghai 200031,China bShanghai Institute of Planned Parenthood Research,Shanghai 200032,Chinaa r t i c l e i n f o Article history:Available online 3August 2012Communicated byGray Brewer Keywords:Method MicroRNALiquid hybridizationAvidin–biotin detection system Color developmenta b s t r a c tCurrently,two methods,PCR and Northern blot,are widely used to detect individual microRNAs (miRNA).Although PCR is highly sensitive,false positives and difficulties of primer design discourage its use.While a Northern blot is an effective tool,traditional Northern blot protocols are complicated,time-consuming,and usually inconvenient for users.Liquid Northern blot methods are rapid but require instruments for detection of fluorescent signals.Here,we describe an alternative protocol,liquid hybridization and color development (LHCD),based on the rapidity of liquid hybridization and the signal amplification of avidin–biotin complex (ABC)for detection.LHCD can distinguish a one-nucleotide difference within a miRNA family and allow for the sensitive detection of 2.5f mol of miRNAs.Furthermore,LHCD is not only simple and rapid,but detection is visual and so it does not require expensive equipment.LHCD is easy to learn and convenient for miRNA analyses.Ó2012Elsevier Inc.All rights reserved.1.IntroductionMicroRNAs (miRNAs)are $21-nucleotide RNAs in plants,ani-mals and microbes.They have emerged as key post-transcriptional regulators of gene expression and have revolutionized our compre-hension of gene expression [1,2].Predictions suggest that about one-third of all protein-coding genes are regulated by miRNAs [3].In mammals,miRNAs are predicted to control the activity of $50%of all protein-coding genes,and are involved in the regula-tion of almost every cellular process investigated so far [2].Impor-tantly,their altered expression is associated with many human pathologies [2].To date,release 18of the miRBase sequence data-base contains 21,643mature miRNAs from 168species (/),and novel molecules are constantly discov-ered.However,the biological characterization and the functional confirmation of most miRNAs remain to be investigated.Since the first miRNA gene was discovered in 1993[4–6],great advances have been made in miRNA biology.However,the smallsize of miRNAs increases the technical difficulty of their identifica-tion,spatiotemporal detection,and functional confirmation.Gen-erally,to investigate an individual miRNA,PCR and Northern blotting are used to measure miRNA expression levels in vitro.PCR is undoubtedly highly sensitive [7],however,the rates of false positives and difficulties designing primers limit its use.Northern blotting is the gold standard for directly examining the expression of miRNA [8].Traditional Northern blot protocols include fraction-ating small RNAs by gel electrophoresis;transferring the separated RNA fragments onto a nylon membrane;over-night hybridization;and hours to days or even months of autoradiography [9,10].The method is complex,lengthy,and inconvenient and in general,does not lend itself for simple and rapid analyses.The new technology of liquid Northern hybridization over-comes these shortcomings and allows quick and simple detection of miRNA [11].However,the use of fluorescent probes can present problems of decreased sensitivity due to fluorescence quenching.Furthermore,instruments for detection of fluorescent signals must be available.Avidin–biotin complex (ABC)method is a standard tool in immunohistochemistry (IHC).The avidin–biotin interaction is one of the strongest known non-covalent interactions (K d =10À15M)[12],making it ideal for both purification and detec-tion strategies [13].Based on our experience with Northern blotting,IHC,and Wes-tern blotting methods,we developed an alternative method of li-quid hybridization and color development (LHCD),which combines the rapid features of liquid hybridization and the ampli-fied signals provided by avidin–biotin complex detection [14,15].1046-2023/$-see front matter Ó2012Elsevier Inc.All rights reserved./10.1016/j.ymeth.2012.07.025Abbreviations:LHCD,liquid hybridization and color development;ABC,avidin–biotin complex;IHC,immunohistochemistry;AP,alkaline phosphatase;HRP,horseradish peroxidase;BCIP/NBT,5-bromo-4-chloro-3-indolyl-phosphate/nitro blue tetrazolium;DAB,3,30-diaminobenzidine;ECL Prime,Amersham™ECL™prime Western blotting reagent;SSWF,Super signal Òwest femto;BSA,bovine serum albumin;TBS,tris-buffered saline.⇑Corresponding authors at:Shanghai Key Laboratory for Molecular Andrology,State Key Laboratory of Molecular Biology,Institute of Biochemistry and Cell Biology,320Yue-Yang Road,Shanghai Institutes for Biological Sciences,Shanghai 200031,China.Fax:+862154921011.E-mail addresses:lixq@ (X.Li),ylzhang@ (Y.Zhang).We describe a LHCD protocol that provides an easy-to-learn and convenient-to-use tool for detecting miRNAs.2.Method2.1.OutlinePurified small RNAs are hybridized in buffer with50biotin-la-beled DNA probes.The hybridized mixture is dotted onto a nylon membrane after non-hybridized probes are digested with Exonu-clease I.The membrane is then incubated with ABC.Finally,the membrane is developed with BCIP/NBP or DAB to produce colori-metric end products;ECL prime can be used to produce light for detection(Fig.1).2.2.Liquid hybridizationHybridization buffer is pipeted into an Eppendorf tube.Synthe-sized or isolated small RNAs and50biotinylated probes are added into the hybridization buffer,mixed thoroughly,and heated at 94°C for4min.The hybridization reaction is performed at42–65°C for60min.Finally,digest non-hybridized probes with Exo-nuclease I at37°C for30min.2.3.Color developmentDot the digested hybridization mixture onto a nylon membrane, dry,and perform ultraviolet crosslinking.Block the membrane with10%BSA,then incubate the membrane with ABC–AP or ABC–HRP at37°C for30min.Wash the membrane with TBS buffer six times.Finally,develop with BCIP/NBP,or DAB,or ECL Prime.2.4.Experimental protocol2.4.1.Prepare total RNA sampleIsolate total RNAs by adding TRIzol(Invitrogen)to cells follow-Fractionator System(Ambion,USA)can be used according to the manufacturer’s instructions.2.4.3.Prepare reagents and materialsPrepare hybridization buffer,50biotinylated DNA probes,Exo-nuclease I,BSA,nylon membrane,ABC–AP or ABC–HRP,1ÂTBS, and BCIP/NBT,DAB,ECL Prime,or SSWF.Hybridization buffer(Buf-fer A:30mmol/L Sodium phosphate buffer(pH8.0),0.3mol/L of NaCl,10mmol/L of EDTA(11);or Buffer B:1ÂExonuclease I).50 biotinylated DNA probes are cheaper,and can be easily synthesized by commercial company(e.g.,Takara,Japan).Exonuclease I,BSA, ABC–AP,ABC–HRP,1ÂTBS,Triton-X-100,Tween-20,BCIP/NBT, and DAB are common inexpensive reagents readily available from commercial sources.Here,Exonuclease I was ordered from NEB (USA);BSA,Triton-X-100,Tween-20,ABC–AP,ABC–HRP,BCIP/ NBT,and DAB from Boster(China),1ÂTBS buffer from Dycent Bio-tech(China);ECL Prime from Amersham(USA).SSWF(Super Sig-nalÒWest Femto)is expensive and is available from Thermo Scientific(USA).Nylon membrane is from Roche(Switzerland). 2.4.4.Liquid hybridizationUp to16l L hybridization buffer is loaded into a200l L Eppen-dorf tube.A specific amount of small RNAs(such as20pmol)and50 biotinylated probes(such as20pmol)is added into the hybridiza-tion buffer;mix thoroughly and heat the mixture to94°C for 4min.Next,carry out the hybridization reaction by incubating the mixture in a water bath at42–65°C for60min.Finally,remove non-hybridized,single-strand probes thoroughly by incubating the reaction mixture with Exonuclease I(20U/l l,2l l)at37°C for 30min.2.4.5.Color developmentThe above digested mixture is50%diluted with1.5M NaCl.Spot a specific volume(0.5l L)of the diluted mixture onto a nylon membrane with a micropipettor,then air dry for10or5min at 50°C.Crosslink with ultraviolet90s(Energy:3,000,CL-1000Ultra-violet crosslinker)at room temperature.Next,block the membraneFig.1.Schematic diagram of procedures.Purified small RNAs are hybridized in buffer with50biotin-labeled DNA probes.The mixture is spotted on a nylon membrane after digestion of non-hybridized probes with Exonuclease I.The membrane is then incubated with ABC and is developed with BCIP/NBT,DAB,or ECL to produce colorimetric end products that can be seen by eye.Fig. 2.Selection of hybridization buffers.(A)Buffer A is30mmol/L sodium phosphate buffer(pH8.0),0.3mol/L NaCl,and10mmol/L EDTA.(B)Buffer B is ÂExonuclease I buffer.The indicated amounts of a synthesized22-nt small RNA (UCGGUCAGUCUGGGGCAGGCAA)and its antisense50biotin-labeled DNA probe (gtTTGCCTGCCCCAGACTGACCGA)were hybridized in the indicated buffers at55°C, digested with Exonuclease I,and0.5l l of each reaction was spotted on the membrane.Alkaline phosphatase-labeled ABC was employed and BCIP/NBT was selected for color development.152X.Li et al./Methods58(2012)151–155hybridization membranes.(A)Positively charged nylon membrane from Roche applied science(cat no.,11417240001);60207);(C)Hybond-N+membrane optimized for nucleic acid transfer from Amersham Pharmacia/GE healthcare charged nylon membrane from AMBION(cat no.,0711004);(E)GeneScreen™–plus hybridization transfer membrane PVDF membrane from Amersham Pharmacia/GE healthcare(cat no.,RPN303F);(G)Whatman Protran™nitrocellulose 10401396).The indicated amounts of small RNA described in Fig.2were hybridized and spotted on the indicated membranes.Roche provided the greatest signal com-NC membrane had little background,butPVDF and NC had comparable sensitivity backgrounds but were less sensitive than the ny-Roche.However,PVDF requires a methanolthus chose nylon membrane from RochehybridizationRNAs were used to examine the sensitivity ofTo evaluate the specificity of the liquid hybridization system,a series of hybridizations were performed with the antisense of Rno–miR-29a as probe to assess whether the probe could distinguish between the members of the Rno–pared to Rno–miR-29a,Rno–miR-29b and Rno–miR-29c containfive-base and one-base mismatches,respectively(Fig.5A).The hybridization results indicated that Rno–miR-29a probe did not hybridize with the other member miRNAs(Fig.5B–D).Thus,the procedure can distinguish single nucleotide differences in sequence,consistent with a report of FITC-labeled probes[11].3.5.Detection of tissue miRNAsDetection of Rno–miR-29a was performed with small RNAs from a variety of tissues.Eight nanograms of total small RNA from rat epididymis,heart,intestine,liver,testis,seminal vesicle,and kidney were analyzed by liquid Northern hybridization at61°C. Expression of miRNA-29a was easily detected in these tissues (Fig.6).Similar results were obtained with color development for 1min with ECL prime,30s with BCIP/NBT,and5s with DAB.The background with BCIP/NBT was low,and less than DAB;ECL had little background as well.Additionally,expression of miRNA-21 was examined in2ng of total small RNAs from these tissues.How-ever,signals were low,and ECL prime yielded no signals(data not shown).Consequently,to increase sample mass per spot,12ng of sample RNA was spotted onto the nylon membrane at the same spot6times(2ng each time);consecutive spotting avoids pipet-ting too much volume onto the membrane at one time.While, ECL prime yielded no signals after20min development,SSWF provided ample signals for detection(data not shown).Thesehybridization with different color development reagents.(A)Color developed with BCIP/NBT.(B)Color developed with DAB.min.The red arrow indicates the most sensitive detection.The hybridization treatments were as described inexperiments indicated that the liquid hybridization and color development system is applicable for detecting miRNAs from tis-sue samples.4.Tips and troubleshootingExonuclease I catalyzes the30–50removal of nucleotides from single-stranded DNA.To confirm removal of non-hybridized, single-strand probes by Exonuclease I,it is important to use a neg-ative control.When preparing miRNA samples,it is important to purify them by gel or by other methods to minimize cross-hybrid-ization with their ually,we cannot detect miRNA precursors for most of miRNA species,so purification procedures are generally not required.For hybridization buffer,we recommend1ÂExonuclease I buf-fer since it is very simple and effective.For hybridization time,1h is usually sufficient;incubation greater than1h does not signifi-cantly enhance signal intensity[11].For hybridization tempera-ture,we recommend42°C to obtain high hybridization-signal intensity[11],but only if negative controls have little or no signals. However,for distinguishing members of miRNA families at single-nucleotide resolution,the hybridization temperature will require optimization depending on the sequence of the probe used,as well as the cell/tissue type.For instance,we can differentiate rat miR-NA-29a and miRNA-29b/c with a61°C hybridization temperature (Fig.5).Consistent with traditional Northern blotting,higher temperature yields less signal strength,while lower temperature yields higher signal strength.For color development,BCIP/NBT and DAB are widely used chromogenic substrates for IHC,while ECL and SSWF are com-monly used chemiluminogenic substrates for Western blot. Whether using BCIP/NBT or DAB,blocking the membrane with BSA or other materials is required to minimize non-specific signals. ECL Prime and SSWF were used in this procedure for chromogenic substrates,not chemiluminescent substrates and provided low backgrounds in general.However,optimal signal-to-noise was ob-tained with BCIP/NBT.Finally,it is essential to keep the sample-spotted membrane wet at all times to prevent high backgrounds.Moreover,0.1%Tri-ton-X-100must be included when ABC is used on the membrane, since it stabilizes the enzyme activity of AP and HRP.5.Concluding remarksTraditional solid-phase Northern blotting is labor intensive and requires special facilities.Newly developed liquid-phase hybridiza-tion procedures overcome these problems.However,fluorescent labeling techniques raise concerns about impaired sensitivity and the need forfluorescence detectors.We have combined liquid hybridization and color development,LHCD,to take advantage of the rapidity of liquid hybridization and the amplification of signals provided by the avidin–biotin system.This makes detecting miR-NAs more convenient because the signals are visible by eye and the color-developed membranes can serve as a permanent record. Furthermore,depending on the requirements,one can select spe-cial membranes or color development reagents.Moreover,there is little need for special buffer preparation.In conclusion,LHCD is rapid,simple,and visual,providing an easy-to-learn and conve-nient-to-use approach for assessing miRNA expression levels. AcknowledgmentsWe thank all the members of our group for providing assistance and advice.This research was supported by Grants from the National Basic Science Research and Development Project of China (30930053)and the Chinese Academy of Sciences(CAS)Knowledge Innovation Program(KSCX2-EW-R-07).References[1]D.P.Bartel,Cell116(2004)281–297.[2]J.Krol,I.Loedige,W.Filipowicz,Nat.Rev.Genet.11(2010)597–610.[3]B.P.Lewis,C.B.Burge,D.P.Bartel,Cell120(2005)15–20.[4]R.C.Lee,R.L.Feinbaum,V.Ambros,Cell75(1993)843–854.[5]B.Wightman,I.Ha,G.Ruvkun,Cell75(1993)855–862.[6]E.Berezikov,Nat.Rev.Genet.12(2011)846–860.[7]R.Shi,V.L.Chiang,Biotechniques39(2005)519–525.[8]K.A.Cissell,S.K.Deo,Anal.Bioanal.Chem.394(2009)1109–1116.[9]E.Varallyay,J.Burgyan,Z.Havelda,Nat.Protoc.3(2008)190–196.[10]E.Varallyay,J.Burgyan,Z.Havelda,Methods43(2007)140–145.[11]X.Wang,Y.Tong,S.Wang,Int.J.Mol.Sci.11(2010)3138–3148.[12]J.M.Teulon,Y.Delcuze,M.Odorico,S.W.Chen,P.Parot,J.L.Pellequer,J.Mol.Recognit.24(2011)490–502.[13]E.P.Diamandis,T.K.Christopoulos,Clin.Chem.37(1991)625–636.[14]S.M.Hsu,L.Raine,H.Fanger,J.Histochem.Cytochem.29(1981)577–580.[15]V.Chi,K.G.Chandy,J.Vis.Exp.(2007)308.。