Role of Multiple MicroRNAs in the Sexually Dimorphic Expression

Materials and Methods

Site-DMutation of Luciferase Reporter Plasmids -- The mutated plasmids were cloned with standard primers (Supplemental Table 1). DNA sequencing confirmed the nucleotide sequence of these plasmids.

Materials and Methods

Western Blot --Liver tissues were lysed in radioimmunoprecipitation assaylysis buffer (Sangon) with phenylmethanesulfonyl fluoride. Cell samples were lysed in lysis buffer containing 50 mM Tris-HCl (pH 7.4), 1% nonidetP40,150 mM NaCl, 1 mM EDTA, 1 mM phenylmethylsulfonyl, and 100 mM dithiothreitol. Proteins (20mg) were separated by 8% SDS-PAGE. Antimouse Cyp2b9 polyclonal antibody was generated by immunizing rabbits with a peptide of amino acids 462473 from Cyp2b9. Verificationfor the specificity of this antibody was performed . Anti-glyceraldehyde-3phosphate dehydrogenase served as a loading control.
Introduction


The cytochrome P450 (P450) superfamily is a large and diverse group of enzymes that catalyze the metabolism of drugs and carcinogens. Cyp2b9 is a testosterone 16ahydroxylase enzyme showing female-specific expression in many inbred mouse strains, including C57BL/6J (Noshiro et al., 1988). Previous studies have identified some mechanisms involved in the sexually dimorphic expression of Cyp2b9 at the transcriptional level. MicroRNAs are a large family of endogenous noncoding RNAs that regulate gene expression primarily by binding to the 3’-untranslatedregion (3’-UTR) of target genes, resulting in suppressed translation or decreased mRNA stability.
Materials and Methods

Luciferase Assays --various luciferase reporter plasmids were co-transfected with 100nM microRNA mimics and their seed region mutants into Huh7 cells. The entire sequence of microRNA mimics is summarized in Supplemental Table 2. Luciferase activity was analyzed after 72 hours by the DualLuciferase Reporter Assay System.
Materials and Methods
ห้องสมุดไป่ตู้
Establishment of Huh7 Cell Line Stably Expressing. -- Full-length of the mouse Cyp2b9 cDNA was amplifiedby PCR using the primers .The fragment was cloned into pLVX-AcGFP-N1lentiviral expression vector with In-fusion Advantage PCR Cloning Kit (Clontech).The nucleotide sequence of the plasmids was confirmed by DNA sequencing. The plasmid was transfected into the HEK 293T packaging cell line, and 48 hours after transfection, viral supernatantwas collected. Huh7 cells were transfected with pLVX-AcGFP-N1-Cypb9 virus-containing media and were selected in 4 mg/ml puromycin for 7 days, and the pooled cell population was used for subsequent experiments. The expression of Cyp2b9 by was confirmed by Western blot (unpublished data).
Materials and Methods

Animals. --In this study, 3- and 6-week-old male hepatocyte-specific Dicer1 KO C57BL/6 mice were used . Quantitative Real-Time Reverse Transcription-Polymerase ChainReaction. --Total RNA was isolated from the liver , and reverse-transcribed to cDNA , and qRT-PCR analysis was performed. Cyp2b9 mRNA levels were normalized to mouse Gapdh mRNA detected by primers 5’GGCTACACTGAGGACCAGGTT-3’ (forward) and 5’- TGCTGTAGCCGTATTCATTGTC-3’ (reverse). --MicroRNAs were isolated . Reverse transcription and detection of microRNAs were carried out . MicroRNA-specific forward primers were designed according to the manufacturer’s instructions. The microRNA expression levels detected were normalized to mRnu6 levels.
Materials and Methods

Construction of Luciferase Reporter Plasmids. --The 3’-untranslated region(3’-UTR, 376bp) of mouse Cyp2b9 was amplified by polymerase chain reaction (PCR) using cDNA from the liver of a female C57BL/6J mouse. The primers are 5-’ TAGGCGATCGCTCGAGTTGGGGTGAGGGAGCCAG GTGTC-3’(forward) and 5’TTGCGGCCAGCGGCCGCCACACACTATGTGATTCT GT-3’ (reverse). This PCR fragment was cloned into the psiCHECK-2 vector with the In-fusion Advantage PCR Cloning Kit.
Introduction


Dicer1 is an RNase III endonuclease that is essential for the biogenesis of microRNAs, and multiple Dicer1knockout (KO) animal models show significant down-regulation of microRNAs and upregulation of microRNA targeting genes in these models (Hand et al., 2009; Sekine et al., 2009). In this study, we used a hepatocyte-specific Dicer1 KO mouse model, bioinformatics analysis, and in vitro studies to investigate therole of microRNAs in the regulation of sexually dimorphic Cyp2b9.
Special Sectionon Epigenetic Regulation of Drug Metabolizing Enzymes and Transporters Role of Multiple MicroRNAs in the Sexually Dimorphic Expression of Cyp2b9 in Mouse Liver
ABSTRACT



In this study, we found evidence that some microRNAs contributed to the sexually biased expression of Cyp2b9 via post-transcriptional regulation. Luciferase assays revealed that approximate half of these microRNAs repressed luciferase activity in a reporter system containing the 3’-untranslated region (3’-UTR) of Cyp2b9, and also inhibited Cyp2b9 protein expression. MicroRNA seed region mutation or mutations in putative binding sites of the microRNAs in Cyp2b9 3’-UTR led to the loss of the suppression of luciferase activity. There was also a negative correlation between the levels of these microRNAs and Cyp2b9. Our results suggested that multiple microRNAs participated in the regulation of Cyp2b9 expression, and that the lower expression levels of these microRNAs potentially contributed to the femalespecific expression of Cyp2b9 in the livers of C57BL/6J mice.