ENVIRONMENTAL BIOTECHNOLOGY
Real-time PCR assay for the simultaneous quantification of nitrifying and denitrifying bacteria in activated sludge Joke Geets&Micha?l de Cooman&Lieven Wittebolle&
Kim Heylen&Bram Vanparys&Paul De Vos&
Willy Verstraete&Nico Boon
Received:10August2006/Revised:7December2006/Accepted:8December2006/Published online:26January2007 #Springer-Verlag2007
Abstract In order to improve wastewater treatment pro-cesses,a need exists for tools that rapidly give detailed insight into the community structure of activated sludge, supplementary to chemical and physical data.In this study, the advantages of microarrays and quantitative polymerase chin reaction(PCR)methods were combined into a real-time PCR assay that allows the simultaneous quantification of phylogenetic and functional genes involved in nitrifica-tion and denitrification processes.Simultaneous quantifica-tion was possible along a5-log dynamic range and with high linear correlation(R2>0.98).The specificity of the assay was confirmed by cloning and sequencing analyses of PCR amplicons obtained from activated sludge.The real-time assay was validated on mixed liquid samples of different treatment plants,which varied in nitrogen removal rate.The abundance of ammonia oxidizers was in the order of magnitude of106down to104ml?1,whereas nitrite oxidizers were less abundant(103–101order of magnitude). The results were in correspondence with the nitrite oxidation rate in the sludge types.As for the nirS,nirK,and nosZ gene copy numbers,their abundance was generally in the order of magnitude of108–105.When sludge samples were subjected to lab-scale perturbations,a decrease in nitrification rate was reflected within18h in the copy numbers of nitrifier genes(decrease with1to5log units),whereas denitrification genes remained rather unaf-fected.These results demonstrate that the method is a fast and accurate tool for the analysis of the(de)nitrifying community structure and size in both natural and engi-neered environmental samples.
Keywords SYBR Green I real-time PCR.16S rRNA gene. amoA.Nitrite oxidoreductase.nosZ.nirS.nirK. Activated sludge
Introduction
Biological nitrification coupled to denitrification is the most versatile and widely used process in technologies treating nitrogenous wastewater(Mateju et al.1992).Nitrification is achieved through a two-step process involving two different chemolithotrophic bacterial groups.First,ammonia is oxidized to nitrite by ammonia-oxidizing bacteria(AOB). In the second step,nitrite oxidation is carried out by nitrite-oxidizing bacteria(NOB)to produce nitrate.Finally, denitrification involves the reduction of nitrate via nitrite and nitric oxide,to nitrous oxide or dinitrogen gas(Zumft 1997).Denitrifying bacteria exhibit a high taxonomic diversity,most of them belonging to various subclasses of the Proteobacteria,others to Gram-positive bacteria and even Archaea(Philippot2005).
Several studies reported problems with the efficiency of biological systems treating nitrogenous wastewater due to factors such as dissolved oxygen,temperature,pH,inhib-
Appl Microbiol Biotechnol(2007)75:211–221
DOI10.1007/s00253-006-0805-8
Electronic supplementary material Supplementary material is available in the online version of this article at https://www.doczj.com/doc/4f4690507.html,/ 10.1007/s00253-006-0805-8and is accessible for authorized users. J.Geets
:M.de Cooman:L.Wittebolle:W.Verstraete:
N.Boon(*)
Laboratory of Microbial Ecology and Technology(LabMET), Ghent University,
Coupure Links653,
9000Ghent,Belgium
e-mail:Nico.Boon@UGent.be
K.Heylen
:B.Vanparys:P.De V os
Department of Biochemistry,Physiology and Microbiology, Laboratory of Microbiology,Ghent University,
K.L.Ledeganckstraat35,
9000Ghent,Belgium
itors,and intermediates(Painter1986;Schmidt et al.1999;
Wittebolle et al.2005).Recently,Yuan and Blackall(2002)
stressed that optimization of the microbial community
structure and functioning should be a major objective in
the design and operation of a treatment system.Although
developments in reactor designs together with the conven-
tional monitoring of chemical(e.g.NHt4àN;NOà3àN, dissolved oxygen,pH)and physical(e.g.flow rate,
temperature)variables may enable engineers to enhance
the process safety and to optimize the biological reactions
in short time periods,a consistent long-term performance
can only be ensured when the microbial community within
the sludge functions optimally.For this purpose,questions
about community structure,activity and the population
kinetics have to be answered by means of molecular
monitoring tools(Yuan and Blackall2002),which allow
to identify and quantify the microorganisms present in the
wastewater treatment plant.
Several methods are available for assessing the abundance
or diversity of nitrifying communities in ecosystems such as
fluorescence in situ hybridization(FISH,de Beer and
Schramm1999),immunofluorescence probing(Hastings et
al.1998),and denaturing gradient gel electrophoresis
(Kowalchuk and Stephen2001).Because of the taxonomic
diversity of denitrifiers,16S rRNA-based approaches are
rather impractical and most studies target their functional
genes such as the genes responsible for nitrite reduction
(nirS and nirK;Heylen et al.2006)and the nitrous oxide
reductase(nosZ;Throback et al.2004).
However,when the performance of(de)nitrification in
wastewater treatment plants(WWTP)is under investiga-
tion,a need exists for tools that give an insight in the
quantitative distribution of nitrogen-cycling communities in
a large number of samples.A microarray for the detection
of nitrifying bacteria has been designed to accomplish this
need(Kelly et al.2005).Yet the major drawbacks of
microarrays when applied on environmental samples are
their low sensitivity and quantitative accuracy(Wu et al.
2004).Manser et al.(2005)combined FISH with epifluo-
rescence microscopy to rapidly quantify nitrifying bacteria
in activated sludge.However,because of the large spatial
variability of nitrifiers,uncertainties remain about the
reliability of the quantification data.On the other hand,
quantitative polymerase chain reaction(PCR)methods such
as competitive and real-time PCR assays have shown a
much higher sensitivity but are restricted to quantify one
target(de)nitrifying organism or gene at a time(Wallenstein
and Vilgalys2005).
The objective of this research was to explore the
possibility to combine the advantages of microarrays and
quantitative PCR methods into a real-time PCR assay for
the sensitive,accurate,and simultaneous quantification of
nitrifiers and denitrifiers in activated sludge.A SYBR Green I real-time PCR protocol that combined several previously described primer sets targeting the16S rRNA or functional genes of nitrifiers and denitrifiers in an assay setup was developed.The real-time assay allowed the differentiation between different sludge types with regard to (de)nitrifiers and it showed to be an effective tool to follow changes in community size upon lab-scale perturbations of sludge.
Materials and methods
Bacterial cultures
For generating the calibration curves for real-time PCR,the following cultures were used:the ammonia oxidizer Nitro-somonas europaea ATCC19718and the nitrite oxidizer Nitrobacter winogradskyi ATCC25391T were purchased from the American Type Culture Collection,whereas the nitrite oxidizer Nitrospira moscoviensis NCMIB13793T was obtained via the National Collection of Industrial, Marine and Food Bacteria.The denitrifiers Paracoccus denitrificans LMG4049T and Alcaligenes faecalis LMG 1229T were obtained via the BCCM/LMG Bacteria Collection(Ghent,Belgium).DNA of the denitrifying bacterium Pseudomonas stutzeri JM300was kindly pro-vided by Dr.Gesche Braker,Max Planck Institute für Terrestrische Mikrobiologie(Marburg,Germany). Wastewater treatment plant samples
Activated sludge samples were taken at seven WWTP located in Flanders,Belgium,including plants treating domestic wastewater,plants treating the wastewater of paper and food related industries,and plants treating wastewater of chemical industries.Moreover,two uncon-ventional types of biological processes were included.In Table1,an overview is given of characteristic operational parameters and the sludge nitrification rate,as communi-cated by the respective treatment plant operators.All samples were collected from the aerated mixed liquid and 50ml of sample was frozen at?20°C upon arrival in the lab until use.
Genomic DNA extraction
DNA isolation from pure strain cultures was performed by using a Wizard?Genomic DNA clean-up kit(Promega). DNA extracts were obtained from2ml of mixed liquid samples using a protocol modified from Boon et al.(2002) and purified over a Wizard?Minicolumn DNA purification kit(Promega).DNA was resuspended in100μl H2O.For PCR purposes,the DNA concentration was measured
spectrophotometrically using a NanoDrop?ND-1000spec-trophotometer(NanoDrop Technologies)and adjusted to become a concentration of100ngμl?1.
PCR conditions
For the preparation of real-time PCR standards and for specificity check of amplicons obtained from sludge samples,first a PCR amplification step had to be included. Table2shows PCR primers used in this study.PCR amplification of16S rRNA genes,amoA,nxrB,nirK,nirS, cNorB,and nosZ genes was performed in a total volume of 100μl in an Applied Biosystems2720Thermocycler.Each PCR mixture contained1μl template DNA,10μl10×Taq buffer with KCl(50mM),15μM MgCl2,0.1mg ml?1 bovine serum albumin,100μM of each dNTP,2.5U of Taq DNA polymerase(recombinant)and,1μM of each primer. Additional KCl was added to PCR mixtures targeting nxrB, the16S rRNA gene of Nitrobacter,and nosZ,with a final concentration of75mM,in order to increase the specificity at lower annealing temperature(Henegariu et al.1997).The Taq DNA polymerase,dNTPs,and PCR buffer were purchased from Fermentas(Fermentas Life Sciences, Germany).All primers were synthesized by Biolegio (Biolegio BV,the Netherlands).Thermal cycling was carried out by using an initial denaturation step of94°C for4min,followed by35cycles of denaturation at94°C for1min,annealing at50°C for1min,and elongation at 72°C for1min.Cycling was completed by a final elongation step of72°C for10min.Positive controls containing purified DNA from reference organisms were included in all of the PCR amplification experiments along with negative controls and a blank(no DNA added).The PCR products were examined on 1.5%(w/v)ethidium bromide-stained agarose gels.
To verify the specificity of the selected primer sets at50°C (see the simultaneous real-time PCR protocol in the next section),PCR products from sludge sample A1(see Table1) were cloned into the pCR?2.1-TOPO?plasmid vector and Escherichia coli TOP10cells using the TOPO-TA cloning vector kit according to manufacturer’s instructions(Invi-trogen).Clones containing recombinant plasmids were examined for the presence of the appropriate insert by PCR using the corresponding primers and subsequently sequenced(IIT GmbH,Gesch?ftsbereich Biotech,Ger-many).The resulting sequences were deposited in GenBank under accession numbers DQ857294to DQ857315.
Real-time PCR assay
Quantitative PCR was performed on the ABI PRISM?SDS 7000(PE Applied Biosystems).Amplification reactions were carried out with the SYBR Green PCR master mix (Applied Biosystems).As with conventional PCR,KCl was added to real-time PCR mixtures targeting nxrB,the16S rRNA gene of Nitrobacter,and nosZ.An oligonucleotide concentration of300nM and DNA template volume of1μl was added to24μl PCR master mix in MicroAmp Optical 96-well reaction plates.The real-time PCR thermocycling steps for all primer sets were as follows:50°C for2min, 95°C for10min,and40cycles at95°C for1min,50°C for 1min,and60°C for1min.In all experiments,appropriate
Table1Overview of the analyzed activated sludge samples from different WWTP and their operational parameters
Sample Source SVI
(ml g?1)B x
(g COD g?1day?1)
Nitrogen load
(kg N m?3day?1)
SRT(day)Ammonium treatment
efficiency(%)
Domestic wastewater influent
A1Hospital sewage850.0320.0226350
A2Municipal sewage112.50.260.0251982
Carbohydrate-rich influent
B1Paper production610.080.1403692
B2a Paper production1740.920.089 1.671
Industrial organic influent
C1a Pharmaceuticals production780.050.0313873
C2Methylamine derivates production//0.072∞11
C3Treatment of anaerobic digester2430.180.2717099
Special sludges
D1OLAND RBC b0.010.01∞90
D2ABIL c200.012095
SVI Sludge volume index,COD chemical oxygen demand,B x sludge loading rate,SRT sludge retention time
a At the moment of sampling,a process failure was taking place and ammonium was released in the effluent.
b Oxygen limited autotrophi
c nitrifiying-denitrifying(OLAND)rotating biological contactor(RBC)biofilm treating ammonium containing synthetic water;for further details,see Pynaert et al.(2004)
c Ammonium binding inoculum liquid(ABIL);for details,see Grommen et al.(2002)
negative controls containing no template DNA were
subjected to the same procedure to exclude or detect any
possible contamination or carryover.Melting curves were
also routinely checked to confirm purity of the amplified
products.
Quantification of target genes and organisms in sludge
samples
In this study,real-time PCR was based on the use of
fluorogenic dyes(Morrison et al.1999)to quantify the
copy number of target DNA in a sample.The increment
in fluorescence vs reaction cycle was plotted and the
threshold cycle(C t)could be related to the log of the
target gene copy number by the following formula:
log T0?àlog E?C ttlog K,where E is the PCR effi-ciency,T0is the initial amount of DNA and,K is the
calculated initial amount of DNA for a C t value of0.
Standard curves were obtained by plotting C t as a
function of log of the copy number of target DNA.As
target DNA,tenfold serial dilutions of the plasmids
containing the standard sequences,ranging from101to
108serial dilutions,were used.For this purpose,the
appropriate PCR primers were used to amplify the16S
rRNA and amoA of N.europaea ATCC19718,the16S
rRNA and nxrB of N.winogradskyi ATCC25391T,nirS
and nosZ genes P.denitrificans LMG4049T,and nirK gene
of A.faecalis LMG1229T.The PCR products were
subsequently cloned and analyzed as described earlier.Plasmid DNA was extracted with a High Pure Plasmid
Isolation Kit(Roche)and the plasmid concentration(nano-
grams per microliter)was measured spectrophotometrically
using a NanoDrop?ND-1000spectrophotometer(Nano-
Drop Technologies).Since the sequences of the vector and
PCR inserts are known,the16S rRNA,amoA,nxrB,nirK,
nirS,cNorB,and nosZ copy numbers could be calculated
from the concentration of extracted plasmid DNA.
All measurements were done in triplicate.Inhibitory
effects of co-extracted substances were examined by
determining the16S rRNA,amoA,nxrB,nirK,nirS,and
nosZ copy numbers after adding106copies of the
corresponding standard plasmid DNA to sludge sample
D2,which was diluted before DNA extraction as such that
there was a difference of at least1log-unit between the
endogenous gene copies and the added plasmid copies.In
this way,it was avoided that the endogenous gene copy
numbers would interfere with the quantification of the
plasmid DNA.
Lab-scale perturbation experiments
Activated sludge(i.e.,mixed liquid)samples A1,C3,and
D2were used in a series of lab-scale experiments.In a first
step,the nitrification and denitrification rates in the samples
were determined by incubating1l of mixed liquid at22°C
for18h,either in the presence of100mg l?1NHt4–N (nitrification)and under constant aeration,or anaerobically
and in the presence of100mg l?1NOà3–N and500mg
Table2Primer sets included in the simultaneous real-time PCR assay
Target gene Primer a Nucleotide sequence(5′–3′)Reference
16S rRNA AOB CTO189f A/B b GGAGRAAAGCAGGGGATCG Kowalchuk et al.(1997)
CTO189f C b GGAGGAAAGTAGGGGATCG Kowalchuk et al.(1997)
CTO654R CTAGCYTTGTAGTTTCAAACGC Kowalchuk et al.(1997)
16S rRNA Nitrobacter sp.FGPS872TTTTTTGAGATTTGCTAG Degrange and Bardin(1995)
FGPS1269′CTAAAACTCAAAGGAATTGA Degrange and Bardin(1995) 16S rRNA Nitrospira sp.NSR1113F CCTGCTTTCAGTTGCTACCG Dionisi et al.(2002)
NSR1264R GTTTGCAGCGCTTTGTACCG Dionisi et al.(2002) Ammonium monooxygenase(amoA)amoA-1F GGGGTTTCTACTGGTGGT Rotthauwe et al.(1997)
amoA-2R CCCCTCKGSAAAGCCTTCTTC Rotthauwe et al.(1997)
Nitrite oxidoreductaseβsubunit(nxrB) of Nitrobacter sp.NxrB1F ACGTGGAGACCAAGCCGGG Vanparys et al.(2006) NxrB1R CCGTGCTGTTGAYCTCGTTGA Vanparys et al.(2006)
Nitrite reductase(nirK)nirK1F GGMATGGTKCCSTGGCA Braker et al.(1998)
nirK5R GCCTCGATCAGRTTRTGGTT Braker et al.(1998) Nitrite reductase(nirS)nirS cd3AF GTSAACGTSAAGGARACSGG Throback et al.(2004)
nirS R3cd GASTTCGGRTGSGTCTTGA Throback et al.(2004) NO reductase(nor)cnorB-2F GACAAGNNNTACTGGTGGT Braker and Tiedje(2003)
cnorB-6R GAANCCCCANACNCCNGC Braker and Tiedje(2003) N2O reductase(nosZ)nosZ-F CGYTGTTCMTCGACAGCCAG Kloos et al.(2001)
nosZ1622R CGSACCTTSTTGCCSTYGCG Throback et al.(2004)
a Primer’s short name used in the reference
b A mixture of CTO189fA/B and CTO189fC at the weight ratio of2:1was used as the forward primer
acetate–COD l?1(denitrification).During these incuba-tions,pH was maintained at pH=7.5.All experiments were sampled during the first4h for both analytical analyzes and molecular investigations.
In a second step,the mixed liquid samples which were incubated under nitrifying conditions were subjected to different types of perturbations.In a first type of perturba-tion,in1.0l of mixed liquid the pH was decreased from pH=7.5to6.5by the addition of HCl(1M)and this acidified environment was maintained for18h.In a second type of perturbation,20mg l?1of allylthiourea(ATU)was added to1.0l of mixed liquid to inhibit all AOB.In a third type,10ml of NaOCl(13%w/v)was added per liter to decrease the total bacterial community.After4h,nitrifica-tion tests were performed to asses the functional impact via analytical analyzes.Samples for molecular analyzes were taken after4and18h.
Analytical analyses
Total ammonical nitrogen(TAN)was determined in the original sludge sample and in microcosm sludge with Nessler’s reagent(Greenberg et al.1992).Concentrations of TAN were analyzed spectrophotometrically(HACH, Cleveland,OH).NOà3and NOà2were measured by ion chromatography(IC761Compact,Metrohm,Switzerland) with a metrosep A supp5column(Metrohm).The eluent was3.2mM Na2CO3and1mM NaHCO3at a flow of 0.7ml min?1.The pH was measured with a Consort C535pH electrode(Endress+Hauser,Belgium)and controlled manually.
Results
Verification of specificity of PCR products
Although all primers used in this study(Table2)were described previously and were intensively tested for specificity by their designers,it had to be tested whether these primer sets would maintain this specificity in case the annealing temperature was lowered to or,as was the case for the NirK1F–NirK5R primer set,was elevated to50°C, in order to allow simultaneous real-time PCR analyses.To increase the amplification efficiency,the KCl concentration in the reaction mixtures targeting nxrB,the16S rRNA gene of Nitrobacter,and nosZ was increased from the standard concentration of50to75mM.Indeed,application of the selected primers to PCR using DNA of both target and non-target organisms,as well as DNA extracted from WWTP samples as template,resulted in a single band of the expected size for target organisms and environmental samples.Figures of agarose gels are provided as Supplementary data.Only with the cNorB primer pair,no amplicon was obtained in any of the WWTP samples although they did work successfully on the DNA of P. stutzeri JM300.Therefore,these primers were not used for further analyses.
Cloning and sequencing analyses of sludge amplicons confirmed the conserved primer specificity(Table3).In addition,melting curve analyses was performed to control that the fluorescent signal obtained in a simultaneous real-time PCR assay originated from specific PCR products and not from artifacts like primer dimers(Stubner2002). Analyses of real-time PCR data showed that a single melting peak corresponding to the standard DNA was observed for all sludge samples(data not shown).
Performance of standard curves and detection limit
Plasmids containing cloned16S rRNA,amoA,nxrB,nirK, nirS,and nosZ genes were used to generate a standard curve relating C t to the number of gene copies.The same linear response(r2>0.98)was observed for all plasmids for six orders of magnitude,ranging from102to107gene copies per microliters DNA(Table4).All standard curves had a high correlation coefficient and similar slope (Table4).After addition of106copies of the CTO standard DNA(i.e.,16S rRNA gene of AOB)to diluted sludge samples,2.7×106±2.8×105copies were obtained out of the 3.7×106±2.2×105expected.Similar variations were obtained for the other primer sets(Table4).The absence of inhibitory substance was also confirmed by the similar amplification efficiencies obtained with tenfold dilution of D2sludge DNA extracts(data not shown). Quantification of16S rRNA genes and amoA,nxrB,nirS, nirK,and nosZ genes in WWTP samples
For evaluation of the real-time PCR assay,mixed liquor of seven wastewater treatment plants,with different opera-tional parameters in terms of nitrogen load,nitrification efficiency,etc.,and two specialized ammonia oxidizing sludge types were analyzed(Table1).
The number of target molecules sometimes showed significant differences between the WWTP and sludge types(Table5).For instance,in most samples the abundance of AOB was in the order of magnitude of106, whereas for sample C2a lower abundance was found(2.4×10516S rRNA copies ml?1,7.6×104amoA copies ml?1). Indeed,this WWTP shows the lowest ammonium removal efficiency(11%).Sample B2,originating from a WWTP in which a nitrification failure took place at the moment of sampling,showed a lower abundance of both AOB and NOB(7.4×104AOB16S rRNA copies ml?1, 1.1×104amoA copies ml?1,4.8×103Nitrospira16S rRNA copies
ml ?1,no Nitrobacter -related genes detected).Also,sludge sample C1,which showed a nitrification failure at the moment of sampling as well,still had a significant AOB gene copy number (106order of magnitude),but only a very low amount of NOB 16S rRNA genes was detected (1.1×103Nitrospira 16S rRNA copies ml ?1,1.1×101Nitro-bacter 16S rRNA copies ml ?1)in comparison to the other sludge samples.The D1sample showed very few NOB as well:only Nitrospira sp.were detected (5.4×102Nitrospira 16S rRNA copies ml ?1).This result is in correspondence with the lack of nitrite oxidation in this sludge type (Pynaert et al.2002).As for the nirS and nirK gene copy
numbers,differences varied as well.In sample B2,the abundance of nirK was low (4.0×104copies ml ?1)in comparison to other samples where its abundance was in the order of magnitude of 107–105.The lowest abundance of nirS and nosZ was found in sample D2,3.1×103nirS copies ml ?1,in comparison to other samples where its abundance was in the order of magnitude of 107–106,and 6.6×105nosZ copies ml ?1,whereas overall,its copy number varied between 108and 106.
Moreover,the proportion of the quantified genes with respect to total bacterial 16S rRNA gene copy number significantly differed across WWTPs.For instance,for
Table 4Efficiency and sensitivity of individual real-time PCR assays Target gene
Primer set
Efficiency Sensitivity (copy number μl ?1DNA)r 2
Slope
Linearity range Expected value (×106)Obtained value×10616S rRNA AOB
CTO189f A/B/C –CTO654R 0.98?3.1102–108 3.7 2.716S rRNA Nitrobacter sp.FGPS1269′–FGPS8720.98?3.3101–107 3.2 2.116S rRNA Nitrospira sp.
NSR 1113F –NSR 1264R 0.99?3.2101–107 3.1 3.2Ammonium monooxygenase (amoA )amoA-1F –amoA-2R 0.99?3.3101–108 3.1 3.7Nitrite oxidoreductase type B (nxrB )NxrB1F –NxrB1R
0.99?3.5101–1077.77.1Nitrite reductase (nirK )nirS cd3AF –nirS R3cd 0.98?3.8102–108 3.1 3.5Nitrite reductase (nirS )nirK 1F -nirK 5R 0.99?3.6101–108 4.2 3.7N 2O reductase (nosZ )nosZ-F –nosZ 1622R 0.98?3.6
102–108
2.7
3.6
Table 3Cloned gene 16S rRNA and functional sequences obtained from wastewater treatment plant A2Primer set
Clone
GenBank accession no.
Nearest match in BLASTN analysis Gene (accession no.)
Host
Nucleotide identities (%)CTO189f A/B A2CTO1DQ85730016S rRNA (AY186222)Uncultured Nitrosomonas clone AZP2-8100CTO189f C A2CTO2DQ85730116S rRNA (DQ154799)Uncultured Nitrosomonas clone LKB7
99CTO654R A2CTO3DQ85730216S rRNA (AY543087)Uncultured Nitrosomonas sp.clone 20BAFln199FGPS1269′A2FGPS1DQ85730516S rRNA (CP000319)Nitrobacter hamburgensis 100FGPS872A2FGPS2DQ85730616S rRNA (CP000319)N.hamburgensis
100A2FGPS3DQ85730716S rRNA (CP000115)Nitrobacter wynogradskyi
99NSR 1113F A2NSR1DQ85729716S rRNA (AF314422)Uncultured Nitrospirae PHOS-HE34100NSR 1264R A2NSR2DQ85731316S rRNA (AF314422)Uncultured Nitrospirae PHOS-HE3498A2NSR3DQ85731416S rRNA (AF314422)Uncultured Nitrospirae PHOS-HE34
95amoA-1F A2amo1DQ857294amoA (AY356421)Uncultured bacterium clone Marshall-66W 98amoA-2R A2amo2DQ857295amoA (AY702583)Uncultured bacterium clone P22-4998A2amo3DQ857296amoA (AY702583)Uncultured bacterium clone P22-4998NorB-F A2norB1DQ875309norB (AM114505)Nitrobacter sp.100NorB-R A2norB2DQ857310norB (L76189)N.wynogradskyi 98A2norB3DQ857311norB (AM114509)Nitrobacter sp.
82nirS cd3AF A2nirS1DQ857303nirS (AB162260)Uncultured bacterium clone S-Z4
83nirS R3cd A2nirS2DQ857304nirS (AF549019)Uncultured organism clone A09-05-37087A2nirS3DQ857312nirS (DQ177110)Uncultured bacterium clone 3S5186nirK 1F A2nirK1DQ857298nirK (AB162330)Uncultured bacterium clone K-A1887nirK 5R A2nirK2DQ857299nirK (DQ182188)Uncultured bacterium clone KMP5097A2nirK3DQ857315nirK (DQ182187)Uncultured bacterium clone KMP696nosZ-F A2nosZ1DQ857308nosZ (AY955143)Uncultured bacterium clone ZRAMO2
89
T a b l e 5C o p y n u m b e r s o f (d e )n i t r i f i e r g e n e s /o r g a n i s m s a n d r a t i o s o f t a r g e t g e n e s a n d 16S r R N A f r o m t o t a l b a c t e r i a i n t h e d i f f e r e n t W W T P s a m p l e s a s d e t e r m i n e d b y t h e s i m u l t a n e o u s r e a l -t i m e P C R a s s a y
S a m p l e T a r g e t g e n e c o p y n u m b e r p e r m l o f m i x e d l i q u i d
a ,b
16S r R N A A O B
R a t i o 16S A O B /16S c
a m o A R a t i o a m o A /16S c 16S r R N A N i t r o
b a
c t e r s p .R a t i o 16S N i t r o b a c t e r /16S c
n x r B R a t i o n x r B /16S c
16S r R N A N i t r o s p i r a s p .R a t i o 16S N i t r o s p i r a /16S c
n i r K R a t i o n i r K /16S c n i r S R a t i o n i r S /16S c
n o s Z
R a t i o n o s Z /16S c
A 15.6×106
(1.5×106)0.028
1.1×106
(1.0×106)0.006
3.6×106
(1.6×106)0.0181.5×106(0.3×106)0.00754.7×105
(2.3×105)0.00233.7×106
(0.5×106)0.01852.9×107
(1.5×107)0.15
1.4×108
(1.3×108)0.70
A 21.1×106
(0.7×106)0.01
8.3×105
(2.2×105)0.009
n .d ./n .d ./
1.8×107
(0.8×107)0.203.7×105
(0.9×105)0.0042.1×105
(3.0×105)0.0028.9×107
(3.1×107)0.98
B 13.0×106
(0.3×106)0.001
3.0×106
(1.6×106)0.01
n .d ./n .d ./1.1×107
(0.4×107)
0.0376.0×105
(2.9×105)0.0023.9×107
(3.3×107)0.132.5×108
(1.7×108)
0.83
B 27.4×104
(2.1×104)0.003
1.1×104
(5.6×104)0.0004n .d .
/n .d ./4.8×103
(3.1×103)0.00024.0×104
(3.0×104)0.00161.7×106
(0.4×106)0.0682.1×107
(1.8×107)0.84
C 11.8×107
(0.9×107)0.45
3.9×107
(3.3×107)0.98
1.1×103
(0.2×103)0.000031.7×103(1.3×103)0.000041.1×101
(5.6×101)0.00000021.1×106
(0.6×106)0.02753.5×106
(0.9×106)0.0884.3×106
(1.4×106)0.11
C 22.4×105
(1.0×105)0.016
7.6×1050.051
n .d ./n .d ./2.1×103
0.000144.0×106
(2.6×106)0.274.2×106
(3.1×106)0.281.0×107
(0.6×107)0.67
C 34.4×106
(3.0×106)0.15
2.0×106(1.9×106)0.067n .d .
/n .d ./2.7×107
(0.4×107)0.901.4×105
(0.9×105)0.00471.2×106
(1.0×106)0.0405.6×106
(4.1×106)
0.19
D 12.7×108
(2.0×108)0.54
4.9×108(2.1×108)0.98n .d .
/n .d ./5.4×102
(3.7×102)0.0000017.0×106
(2.1×106)0.0147.0×105
(2.1×105)0.00145.6×106
(2.8×106)0.01
D 2
1.5×108
(0.2×108)
0.13
7.2×107(1.1×107)
0.061.0×106
(1.1×106)0.00084.8×106(2.1×106)0.0046.5×105
(2.9×105)
0.000542.8×107
(0.9×107)0.0233.1×103
(0.4×103)0.00000256.6×105
(1.6×105)
0.00055
a
S t a n d a r d e r r o r s i n d i c a t e d i n p a r e n t h e s i s .b
n .d .N o t d e t e c t e d (i .e .b e l o w l i m i t o f q u a n t i f i c a t i o n )c R a t i o i s i n c o r r e l a t i o n t o t h e b a c t e r i a l t a r g e t n u m b e r .
amoA this ratio ranged from0.0004(sample B2)to0.98
(sample D1)for gene copy number per milliliter of mixed
liquid,whereas for Nitrospira sp.,it ranged from0.0000002
(sample C1)to0.90(sample C3)for gene copy number per
milliliter of mixed liquid(Table5).
Quantification of16S rRNA and amoA,nxrB,nirS,nirK,
and nosZ genes in the perturbation experiments
For perturbation experiments,activated sludge(i.e.,mixed
liquid)A1,C3,and D2were sampled at another point of
time than the samples used for assay analyses(see above).
They were first analyzed for their nitrification and
denitrification rates to verify the sludge functioning in the
lab.The nitrification rate in samples A1and C3(both
19mg NH4–N g?1volatile suspended solids(VSS)day-1) turned out to be five times lower than in sample D2
(146mg NH4–N g?1VSS day-1).Sample C3shows the highest denitrification rate(106mg NO3–N g?1VSS day-1), followed by sample A1(34mg NO3–N g?1VSS day-1). Sample D2showed very low denitrification activity(12mg NO3–N g?1VSS day-1).
In the second step,these mixed liquid samples were
subjected to different types of perturbations:pH decrease,
addition of NaClO,addition of allylthiourea.The original
samples were compared to the stressed samples by means
of real-time PCR assay analyses.After4h incubation in a
stressed environment,no remarkable differences in copy
numbers were found compared to the original samples(data
not shown).However,after18h,changes in gene copy
numbers were detectable(Fig.1a–c).
In a first type of perturbation,the pH was decreased
from pH=7.5to6.5by the addition of HCl.As a result,
the nitrification rate in sample A1dropped by91%,and
this was reflected in the copy number of16s rRNA
genes of AOB and Nitrobacter sp.,as well as the copy
number of amoA genes,which had decreased from～105
copies ml?1to below the limit of quantification(Fig.1a).
Also the copy number of nxrB showed a significant
decrease from8.6×105to4.2×102copies ml?1.Changes
in the quantified16S rRNA genes of Nitrospira sp.and
denitrification genes were less pronounced.In sample C3,
the decrease in nitrification rate was only16%.The
quantification data(Fig.1b)showed a similar trend as in
sample A1,i.e.,nitrifier genes had decreased below the
limit of quantification,whereas the copy number of16S
rRNA genes of Nitrospira sp.and of denitrification genes
remained rather stable.On the other hand,in sample D2
the nitrification rate remained rather unaffected(7%
decrease)and only a decrease of1log unit was found
for the gene copy numbers of nitrifiers(Fig.1c).Again,
the gene copy number of denitrifier genes showed no
significant changes.
In a second type of perturbations,allylthiourea was added as an inhibitor of nitrification.Samples A1and D2 were affected similarly(79and77%decrease,respective-ly),whereas the nitrification was completely inhibited in sample C3.For sample A1,the gene copy numbers of nitrifiers were less affected than for the pH perturbation:a decrease of 1.5–2log units was measured(Fig.1b). However,under these circumstances,denitrification genes also had a decrease of2–3log units.In sample D2,again, the nitrification-related gene copy numbers remained rather unaffected(Fig.1c).The impact of addition of ATU was most significant in sample C3,where the copy number of 16S rRNA genes of AOB and Nitrobacter sp.,as well as the copy number of amoA genes,had decreased to below the limit of quantification(Fig.1c).However,the quantity of denitrification genes remained unaffected.
Finally,a third type of a stressed environment was created by adding NaOCl.As a consequence,the nitrifica-tion rate in sample A1decreased by37%in sample C3with 63%and58%in sample D2.Except for sample D2,where (de)nitrifier gene copy numbers once more were rather unaffected(Fig.1c),the gene copy numbers of the nitrifiers nirS and nosZ showed a significant decrease to below detection limit of quantification(Fig.1a,b).
Discussion
This study is the first to develop and apply a real-time PCR assay to simultaneously quantify nitrifying and denitrifying communities in environmental samples.Application of the simultaneous real-time PCR assay to sludge samples was performed using SyberGreen as detection system as discussed by Stubner(2002).When a high polymorphism exists between the different target microbial groups,as is the case for denitrifiers(Philippot et al.2002),SyberGreen has an advantage over TaqMan?real-time PCR detection as no additional probes have to be designed.The simultaneous real-time PCR assay showed linearity over five to six orders of magnitude and sensitive down to ten copies per assay.Moreover,the assay is sensitive enough to detect a decrease in the(de)nitrifying community density in environments after perturbations such as acidification, addition of allylthiourea or NaClO.
In real-time PCR analyses,quantification is based on the threshold cycle C t,which is inversely proportional to the logarithm of the initial gene copy number.The threshold cycle values obtained for each sample should be compared with a standard curve to determine the initial copy number of the target gene.Because the rationale behind the real-time PCR assay was to compare quantification data obtained with a range of different primer sets to only one standard series of only one primer set,a PCR efficiency,
which is similar among the different reactions,was required to allow comparison between real-time results obtained with different primer sets (Devers et al.2004;Lopez-Gutierrez et al.2004).Since all standard curves had a high correlation coefficient and similar slope,and thus similar,high PCR efficiencies (E ),the use of the curves as standards was allowed;moreover,the comparison among the results obtained with the various primer sets became possible.Nevertheless,it is recommended to include a positive control with predefined target gene quantity (e.g.,a dilution of the standard series),firstly for melting curve analyses to exclude any possible unspecific real-time detection signal,secondly for verification of the quantified order of magnitude.
The simultaneous real-time PCR assay can be applied for rapid processing of many sample numbers at a time.However,this is only one of the possible experimental setups of this method.Other applications might be the quantification of the (de)nitrifying bacteria at multiple time points or in response to changing process
parameters.
Fig.1Variation in gene copy number (Log 10)per milliliter of mixed liquid during pertur-bation tests with a sample A1,b sample C3,and c sample D2.ATU Allylthiourea
Hence,the real-time PCR assay permits a rapid,high-
throughput analysis and will be useful in studies of community dynamics in natural and engineered ecosys-tems.Moreover,the use of functional genes in this approach opens the possibility to look at gene expression.When the real-time PCR assay was applied to different types of wastewater treating sludge,the obtained data were in correspondence with the nitrite oxidation rate in the sludge types.Also,in case both functional genes and 16S rRNA genes of a bacterial group were targeted (i.e.,for quantification of ammonia oxidizers and the genus Nitro-bacter ),the obtained results were in the same order of magnitude.To determine the importance of a specific bacterial (functional)group with respect to the total bacteria in the environment,the gene copy number of the was compared to the quantity of total bacterial 16S rRNA genes.In this way,significant differences within different WWTP were found.Yet,there was no direct correlation between this ratio and the (de)nitrification activity of the WWTP.The results might be biased because different bacterial groups have different 16S rRNA gene copy numbers,ranging from 1to 13(Fogel et al.1999),whereas the number of functional genes such as the amoA ,nirK ,and the nosZ per organism is expected to be close to the gene copy number obtained by real-time PCR,since bacteria have only one to three copies of these genes per genome (Norton et al.2002;Heylen et al.2006;Philippot 2002).When the real-time PCR assay was used for quantifica-tion of (de)nitrifiers before and after perturbation by pH decrease,NaClO,or allylthiourea,it was observed that,in general,a significant decrease in nitrification rate resulted in a significant decrease in the quantified genes,although there appeared to be a difference in sludge stability towards the type of stress.In some cases,nitrite oxidizers or denitrifiers showed more stringency towards pH stress.Similarly,addition of NaOCl causes a greater shock in one community than in another.These differences are probably related to sludge characteristics such as floc structure and size,decay rate,etc.
In conclusion,the simultaneous real-time PCR assay can be applied as a fast and accurate tool to obtain an insight in the community size of nitrifiers and denitrifiers in both natural and engineered environmental samples.The ratio-nale behind the real-time PCR assay has the advantage that the final setup of primers on the assay is very flexible.The necessary next steps include an increase in the scale of the real-time assay,i.e.,increase in number of primer sets.First,if one wants to use this tool for ecological studies,investigating the nitrogen cycle as a whole,other genes can be added to the assay,such as the gene encoding the alpha subunit of the membrane-bound nitrate reductase narG (Philippot et al.2002),or the nitrogen-fixing gene nifH (Zehr et al.1995).In case one wishes to maintain the focus
on activated sludge communities,the addition of primers targeting organisms such as filamentous actinomycetes that cause sludge foaming and bulking,floc forming bacteria,or pathogens will be useful in the evaluation of the ongoing sludge processes and the effluent quality.
Acknowledgements This work was supported by project grant G.O.A.1205073(2003–2008)of the ‘Ministerie van de Vlaamse Gemeenschap,Bestuur Wetenschappelijk Onderzoek ’(Belgium).The authors thank Han Vervaeren and Robin Temmerman for their critical reading of the manuscript.
References
Boon N,De Windt W,Verstraete W,Top EM (2002)Evaluation of
nested PCR –DGGE (denaturing gradient gel electrophoresis)with group-specific 16S rRNA primers for the analyses of bacterial communities from different wastewater treatment plants.FEMS Microbiol Ecol 39:101–112
Braker G,Tiedje JM (2003)Nitric oxide reductase (norB)genes
from pure cultures and environmental samples.Appl Environ Microbiol 69:3476–3483
Braker G,Fesefeldt A,Witzel KP (1998)Development of PCR primer
systems for amplification of nitrite reductase genes (nirK and nirS )to detect denitrifying bacteria in environmental samples.Appl Environ Microbiol 64:3769–3775
De Beer D,Schramm A (1999)Micro-environments and mass transfer
phenomena in biofilms studied with microsensors.Water Sci Technol 39(7):173–178
Degrange V ,Bardin R (1995)Detection and counting of Nitrobacter
populations in soil by PCR.Appl Environ Microbiol 61:2093–2098Devers M,Soulas G,Martin-Laurent F (2004)Real-time reverse
transcription PCR analyses of expression of atrazine catabolism genes in two bacterial strains isolated from soil.J Microbiol Methods 56:3–15
Dionisi HM,Layton AC,Harms G,Gregory IR,Robinson KG,Sayler
GS (2002)Quantification of Nitrosomonas oligotropha -like ammonia-oxidizing bacteria and Nitrospira spp.from full-scale wastewater treatment plants by competitive PCR.Appl Environ Microbiol 68:245–253
Fogel GB,Collins CR,Li J,Brunk CF (1999)Prokariotic genome size
and SSU rDNA copy number:estimation of microbial relative abundance from a mixed population.Microb Ecol 38:93–113Greenberg AE,Cleseri LS,Eaton AD (1992)Standard methods for the
examination of water and wastewater,18th edn.APHA,Washington Grommen R,Van Hauteghem I,Van Wambeke M,Verstraete W (2002)
An improved nitrifying enrichment to remove ammonium and nitrite from freshwater aquaria systems.Aquaculture 211:115–124Hastings RC,Saunders JR,Hall GH,Pickup RW,McCarthy AW
(1998)Application of molecular biological techniques to a seasonal study of ammonia oxidation in a eutrophic freshwater lake.Appl Environ Microbiol 64:3674–3682
Henegariu O,Heerema NA,Dlouhy SR,Vance GH,V ogt PH (1997)
Multiplex PCR:critical parameters and step-by-step protocol.BioTechniques 23:504–511
Heylen K,Vanparys B,Wittebolle L,Verstraete W,Boon N,De V os P
(2006)Cultivation of denitrifying bacteria:Optimization of isolation conditions and diversity study.Appl Environ Microbiol 72:2637–2643
Kelly JJ,Siripong S,McCormack J,Janus LR,Urakawa H,El
Fantroussi S,Noble PA,Sappelsa L et al (2005)DNA microarray detection of nitrifying bacterial 16S rRNA in wastewater treatment plant samples.Water Res 39:3229–3238
Kloos K,Mergel A,Rosch C,Bothe H(2001)Denitrification within the genus Azospirillum and other associative bacteria.Aust J Plant Physiol28:991–998
Kowalchuk GA,Stephen JR(2001)Ammonia-oxidizing bacteria:a model for molecular microbial ecology.Annu Rev Microbiol 55:485–529
Kowalchuk GA,Stephen JR,De Boer W,Prosser JI,Embley TM, Woldendorp JW(1997)Analyses of ammonia-oxidizing bacteria of theβsubdivision of the class Proteobacteria in coastal sand dunes by denaturing gradient gel electrophoresis and sequencing of PCR-amplified16S ribosomal DNA fragments.Appl Environ Microbiol63:1489–1497
Lopez-Gutierrez JC,Henry S,Hallet S,Martin-Laurent F,Catroux G,Philippot L(2004)Quantification of a novel group of nitrate-reducing bacteria in the environment by real-time PCR.
J Microbiol Methods57:399–407
Manser R,Muche K,Gujer W,Siegrist H(2005)A rapid method to quantify nitrifiers in activated sludge.Water Res39:1585–1593 Mateju V,Cizinska S,Krejci J,Janoch T(1992)Biological water denitrification—a review.Enzyme Microb Technol14:170–183 Morrison TB,Ma Y,Weis JH,Weis JJ(1999)Rapid and sensitive quantification of Borrelia burgdorferi-infected mouse tissues by continuous fluorescent monitoring of PCR.J Clin Microbiol 37:987–992
Norton JM,Alzerreca JJ,Suwa Y,Klotz MG(2002)Diversity of ammonia monooxygenase operon in autotrophic ammonia-oxi-dizing bacteria.Arch Microbiol177:139–149
Painter HA(1986)Nitrification in the treatment of sewage and wastewaters.In:Prosser JI(ed).Nitrification.IRL Press,Oxford, UK,pp185–211
Philippot L(2002)Denitrifying genes in bacterial and Archaeal genomes.Biochim Biophys Acta1577:355–376
Philippot L(2005)Tracking nitrate reducers and denitrifiers in the environment.Biochem Soc Trans33:200–204
Philippot L,Piutti S,Martin-Laurent F,Hallet S,Germon JC(2002) Molecular analyses of the nitrate-reducing community from un-planted and maize-planted soils.Appl Environ Microbiol 68:6121–6128
Pynaert K,Sprengers R,Laenen J,Verstraete W(2002)Oxygen-limited nitrification and denitrification in a lab-scale rotating biological contactor.Environ Technol23:353–362Pynaert K,Smets BF,Beheydt D,Verstraete W(2004)Start-up of autotrophic nitrogen removal reactors via sequential biocatalyst addition.Environ Sci Technol38:1228–1235
Rotthauwe JH,Boer W,Liesack W(1997)The ammonia monoxyge-nase structural gene amoA as a functional marker:molecular fine scale analyses of natural ammonia oxidizing populations.Appl Environ Microbiol63:4704–4712
Schmidt I,Gries T,Willuweit T(1999)Nitrification—Fundamentals of the metabolism and problems at the use of ammonia oxidizers.
Acta Hydrochim Hydrobiol27:121–135
Stubner S(2002)Enumeration of16S rDNA of Desulfotomaculum lineage1in rice field soil by real-time PCR with SyberGreen detection.J Microbiol Methods50:155–164
Throback IN,Enwall K,Jarvis A,Hallin S(2004)Reassessing PCR primers targeting nirS,nirK and nosZ genes for community surveys of denitrifying bacteria with DGGE.FEMS Microbiol Ecol49:407–417
Vanparys B,Bodelier P,De V os P(2006)Validation of the correct start codon of norX/nxrX and universality of the norAXB/ nxrAXB gene cluster in Nitrobacter species.Curr Microbiol 53(3):255–257
Wallenstein MD,Vilgalys RJ(2005)Quantitative analyses of nitrogen cycling genes in soils.Pedobiologia49:665–672
Wittebolle L,Boon N,Vanparys B,Heylen K,De V os P,Verstraete W (2005)Failure of the ammonia oxidation process in two pharmaceutical wastewater treatment plants is linked to shifts in the bacterial communities.J Appl Microbiol99:997–1006
Wu L,Thompson DK,Liu X,Fields MW,Tiedje JM,Zhou J(2004) Development and evaluation of microarray-based whole-genome hybridization for detection of microorganisms within the context of environmental applications.Environ Sci Technol38:6775–6782
Yuan Z,Blackall LL(2002)Sludge population optimisation:a new dimension for the control of biological wastewater treatment systems.Water Res36:482–490
Zehr JP,Mellon M,Braun S,Litaker W,Steppe T,Paerl HW (1995)Diversity of heterotrophic nitrogen-fixation genes in a marine cyanobacterial mat.Appl Environ Microbiol61:2527–2532
Zumft WG(1997)Cell biology and molecular basis of denitrification.
Microbiol Mol Biol Rev61:533–616