R e p r o d u c e d f r o m C r o p S c i e n c e . P u b l i s h e d b y C r o p S c i e n c e S o c i e t y o f A m e r i c a . A l l c o p y r i g h t s r e s e r v e d .
Engineering Higher Yield and Herbicide Resistance in Rice by Agrobacterium -Mediated Multiple Gene Transformation
M.X.Cao,J.Q.Huang,*Z.M.Wei,Q.H.Yao,C.Z.Wan,and J.A.Lu ABSTRACT
sizes elevated quantities of a homodimeric hemoglobin (VHb)under hypoxic growth conditions.Expression of The Vitreoscilla hemoglobin gene (VHb ),trans -zeatin secretion VHb in heterologous hosts often enhances growth and gene (tzs ),and the modified 5-enolpyruvylshikimate-3-phosphate syn-product formation (Holmberg et al.,1997;Ramandeep thase gene (EPSPS ),as linked expression cassettes,were simultane-et al.,2001).A role in facilitating oxygen transfer to the ously introduced into immature embryos of the rice (Oryza sativa L.)cultivars Xiushui-11,Qiufeng,Youfeng,and Hanfeng by Agro-respiratory membranes is one explanation of its cellular bacterium tumefaciens .A total of 1153transgenic lines composed of function.Holmberg et al.(1997)reported that trans-4222plants were obtained through selection for hygromycin (hyg)B genic tobacco (Nicotiana tabacum L.)plants expressing resistance.Genomic polymerase chain reaction (PCR),southern and VHb exhibited enhanced growth,on average 80to 100%northern blotting analyses,and other relative tests showed that all more dry weight after 35d of growth compared with transgenes had been integrated into the rice genome and expressed wild-type controls.Furthermore,germination time was effectively.Approximately 90.2%of the transgenic lines harbored reduced from 68d for wild-type tobacco to 34d,and all the transgenes.Expression analysis revealed that all transgenes the growth phase from germination to flowering was coexpressed stably in transgenic plants,and the frequency of coexpres-35d shorter for the VHb -expressing transgenes.Trans-sion was about 85%.Statistically significant increases were observed genic plants contained,on average,30to 40%more in plant height,panicle length,total grains per panicle,and filled grains per panicle in transgenic plant lines compared with the control.chlorophyll and 34%more nicotine than controls.Our study demonstrates a possible way to introduce different trans-Two Ti plasmid genes,tzs and ipt ,code for proteins genes as linked expression cassettes within a single vector into the with isopentanyl transferase (IPT)activity in vitro,and plant genome.Moreover,this transgenic approach has great potential both genes are responsible for trans -zeatin secretion in in developing new rice cultivars with increased productivity and en- A.tumefaciens (Heinemeyer et al.,1987).There are hanced tolerance to the herbicide glyphosate.
numerous examples of ipt expression in plants using a range of constitutive,tissue-specific,or inducible pro-moters (Ma et al.,2002;Mckenzie et al.,1998;Roeckel P
lant genetic engineering often demands stable co-et al.,1998).The physiological effects of the resulting transformation of two or more transgenes.For ex-abnormally high cytokinin levels include stunted growth,ample,to achieve resistance against a broader range of adventitious shoot formation (loss of apical dominance),pathogens in plants,coexpression of transgenes encod-delayed senescence,and reduced root formation.The ing antimicrobial proteins with different biochemical A.tumefaciens gene tzs,which is present on the nopaline targets is an attractive approach (Halpin et al.,1999).Ti plasmid but is not transferred to plants,is homolo-To produce a particular metabolite in plants,multiple gous to ipt and has a similar function.Heat-induced transgenes that are involved in the biosynthetic pathway expression of a hsp70-tzs construct in oilseed rape re-of the metabolite are cointroduced into plants (Ye et sulted in increased amounts of zeatin-type cytokinins al.,2000).Other examples demonstrate the production with associated symptoms,including increased seed of antibodies or other valuable biomolecules by coexpres-numbers per silique (Roeckel et al.,1998).
sion of multiple genes involved (Peeters et al.,2001;5-Enolpyruvylshikimate-3-phosphate synthase,which Wilde et al.,2002).Multiple genes can be introduced catalyzes the reversible addition of the enolpyruvyl moi-into plants via several strategies,such as one-step trans-ety of phosphoenolpyruvate to shikimate 3-phosphate formation using a single vector containing all the trans-in the shikimate pathway,is located in some enteric genes (Slater et al.,1999),one-step transformation using bacteria and the plastids of higher plants.The wild-type multiple vectors (Campbell et al.,2000),sequential sin-enzyme protein,encoded by the aroA locus in E.coli ,gle-gene transformation steps,and separate transforma-is inhibited by the broad-spectrum herbicide glyphosate,tion events (Bizily et al.,2000).
while a mutagenized strain of Salmonella typhimurium The obligate aerobic bacterium,Vitreoscilla ,synthe-owes its glyphosate tolerance to a single amino acid substitution of P101S (a Proline to Serine amino substi-tution at the 101st codon of the protein)in the EPSPS
M.X.Cao,J.Q.Huang,and Z.M.Wei,National Lab.of Plant Molecu-lar Genetics,Inst.of Plant Physiology and Ecology,Shanghai Inst.for Biological Sciences,Chinese Academy of Sciences,Shanghai 200032,Abbreviations:AS,acetosyringone;DIG,digoxigenin;EPSPS,5-enol-China;Q.H.Yao,Agrobiotech Research Center,Shanghai Academy pyruvylshikimate-3-phosphate synthase;EPSPS ,modified 5-enolpy-of Agricultural Sciences,Shanghai 201106,China;C.Z.Wan and J.A.ruvylshikimate-3-phosphate synthase gene;GUS,?-D-glucuronidase;Lu,Crop Breeding and Cultivation Research Institute,Shanghai hpt ,hygromycin phosphotransferase gene;hyg,hygromycin;ipt ,iso-Academy of Agricultural Sciences,Shanghai 201106,China.Received pentanyl transferase gene;MAR,matrix attachment region;PCR,8Oct.2003.*Corresponding author (jqhuang@https://www.doczj.com/doc/dd17184906.html,).polymerase chain reaction;RBCS,small subunit of ribulose-bisphos-phate carboxylase;SAR,scaffold attachment region;SCC,standard Published in Crop Sci.44:2206–2213(2004).?Crop Science Society of America
saline citrate;tzs ,trans -zeatin secretion gene;VHb ,Vitreoscilla hemo-globin gene.
677S.Segoe Rd.,Madison,WI 53711USA
2206
R e p r o d u c e d f r o m C r o p S c i e n c e . P u b l i s h e d b y C r o p S c i e n c e S o c i e t y o f A m e r i c a . A l l c o p y r i g h t s r e s e r v e d .
CAO ET AL.:AGROBACTERIUM -MEDIATED MULTIPLE GENE TRANSFORMATION
2207
encoded by a mutant aroA gene (Comai et al.,1983;Stalker et al.,1985).The mutant S.typhimurium aroA gene (modified EPSPS gene)was cloned and introduced into crop plants,and the transgenics produced the mu-tant EPSPS and were tolerant to glyphosate (Comai et al.,1985;Fillatti et al.,1987).
Here,we report the introduction into rice immature embryos of VHb,tzs ,and the modified EPSPS gene as linked expression cassettes,each with a different pro-moter and a terminator,within a single vector via Agro-bacterium transformation.Stable integration,expression,and inheritance of transgenes were confirmed by molec-ular and genetic analyses of the transformants and their progenies.Considering the importance of rice as a major crop,developing new cultivars with enhanced productiv-ity and herbicide tolerance would undoubtedly have an enormous impact on global food production.
MATERIALS AND METHODS Construction of Plasmid for Transformation
The VHb gene was designed and synthesized using a succes-sive PCR technique for optimal expression in plants (Gene-bank No.AF274976).Genomic DNA was isolated from a wild A.tumefaciens strain,and the tzs gene associated with trans -zeatin biosynthesis was amplified by PCR,cloned,and se-quenced.In addition,the modified EPSPS gene was cloned and sequenced (Stalker et al.,1985).Three expression cas-settes were constructed respectively.Nos ?Omega enhancer was used for driving the expression of the synthetic VHb gene.The tzs gene was controlled by the pistil-specific STS14promoter derived from potato (Eldik et al.,1996)for over-expression and tissue-specific expression.The modified EPSPS gene was driven by the CaMV35S ?TMV (Tobacco mosaic virus )Omega leader sequence,linked with a chloroplast-tar-geting transit peptide sequence of RBCS (small subunit of ribulose-bisphosphate carboxylase)from Arabidopsis at the 5?region.These three cassettes were linked through constructing two intermediate vectors,pYP1203C and pYP1203D,derived from pCAMBIA1301.A chromosome matrix-attachment re-gion SAR68(Allen et al.,1996,Genebank No.U67919)from tobacco was inserted between the expression cassette of tzs and VHb.The resulting plasmid pYP1203E (21.7kbp),carry-ing five tandem expression cassettes within the T-DNA region (Fig.1),was then transferred into a disarmed Agrobacterium strain EHA105via electroporation.
Materials for Transformation
Four elite japonica rice cultivars,Xiushui-11,Qiufeng,Youfeng,and Hanfeng,were used.Media used for tissue cul-ture and transformation are listed in Table 1.Immature seeds were first surface-sterilized with 75%ethanol for 1min,and then sterilized with 2%sodium hypochlorite for 15min,and further washed several times with sterilized deionized water.The immature embryos were dissected aseptically and cul-F i g .1.S c h e m a t i c r e p r e s e n t a t i o n o f t h e T -D N A r e g i o n i n t h e p Y P 1203E p l a s m i d .5?N O S ,5?-u n t r a n s l a t e d p r o m o t e r r e g i o n o f t h e A g r o b a c t e r i u m t u m e f a c i e n s n o p a l i n e s y n t h a s e g e n e .V H b ,h o m o d i m e r i c h e m o g l o b i n g e n e ;3?r b c s ,3?-u n t r a n s l a t e d t e r m i n a t o r r e g i o n o f t h e A r a b i d o p s i s r b c s g e n e ;S A R 68,c h r o m o s o m e m a t r i x -a t t a c h m e n t r e g i o n (M A R )o f t o b a c c o ;5?S T S 14,t h e p i s t i l -s p e c i f i c p r o m o t e r d e r i v e d f r o m p o t a t o ;t z s ,t r a n s -z e a t i n s e c r e t i o n g e n e ;3?n o s ,3?-u n t r a n s l a t e d t e r m i n a t o r r e g i o n o f t h e n o p a l i n e s y n t h a s e g e n e ;E P S P S ,5-e n o l p y r u v y l s h i k i m a t e -3-p h o s p h a t e s y n t h a s e (E P S P S )g e n e ;R B C S ,t h e c h l o r o p l a s t -t a r g e t i n g t r a n s i t p e p t i d e R B C S f r o m A r a b i d o p s i s a t t h e 5?r e g i o n o f t h e E P S P S e x p r e s s i o n c a s s e t t e ;5?35S ,C a M V 35S p r o m o t e r ;g u s (i n t r o n ),?-g l u c u r o n i d a s e g e n e w i t h a n i n t r o n ;5?D 35S ,d o u b l e C a M V 35S p r o m o t e r ;h p t ,h y g r o m y c i n p h o s p h o t r a n s f e r a s e g e n e ;L B ,l e f t b o r d e r ;R B ,r i g h t b o r d e r ;B g l I I c u t t h e p l a s m i d D N A a t a s i n g l e s i t e b e t w e e n 5?35S a n d G U S g e n e s e q u e n c e
.
tured on solid N 6D 2medium.The cultures were incubated in the dark at 25?1?C for 4to 5d.The compact calli (1–2mm EHA105(pYP1203E)was grown to an OD 600of 0.8(OD is in diameter)derived from the scutella were separated with a optical density)in AAD 1–AS (Table 1).The rice calli were scalpel and used for transformation.
immersed in the bacterial suspension for 20min and then transferred on a piece of filter paper placed on the coculture Transformation and Production of Transgenic Plants
medium N 6D 2–AS (Table 1),and incubated at 25?1?C in darkness for 3d.One-microliter liquid medium (AAD 1–AS)Rice calli were subjected to Agrobacterium -mediated trans-formation using a modified protocol of Hiei et al.(1994).
was dripped onto the surface of the filter paper (Huang et al.,
R e p r o d u c e d f r o m C r o p S c i e n c e . P u b l i s h e d b y C r o p S c i e n c e S o c i e t y o f A m e r i c a . A l l c o p y r i g h t s r e s e r v e d .
2208
CROP SCIENCE,VOL.44,NOVEMBER–DECEMBER 2004
Table 1.Rice tissues culture and transformation media.?
Medium Composition
N 6D 2
N 6medium plus 500–1000mg L ?1casamino acids;500mg L ?1proline;30g L ?1sucrose;2mg L ?12,4-D;7g L ?1agar;pH 5.8N 6D 2–AS N 6D 2medium plus 100?M AS and 10g L ?1glucose,pH 5.2
AAD 1
AA (Toriyama and Hinata,1985);500mg L ?1casamino acids;30g L ?1sucrose;1mg L ?12,4-D;pH 5.2AAD 1–AS AAD 1medium plus 100?M AS
N 6D 2–CH 25N 6D 2medium plus 250mg L ?1cef and 25mg L ?1hyg N 6D 2–CH 50N 6D 2medium plus 250mg L ?1cef and 50mg L ?1hyg
RE 1–CH 50
MS,30g L ?1sucrose,10–20g L ?1sorbitol,1–2g L ?1casamino acids,2mg L ?16-BA,0.25mg L ?1NAA,250mg L ?1cef,50mg L ?1hyg,2g L ?1gelrite,pH 5.8
RE 2–CH 50MS,30g L ?1sucrose,10g L ?1sorbitol,1?2g L ?1casamino acids,2mg L ?16-BA,0.5mg L ?1NAA,50mg L ?1hyg,2g L ?1gelrite,pH 5.8
MS 0
MS major salts,MS minor salts,MS vitamins,20g L ?1sucrose,2g L ?1gelrite,pH 5.8MS 0H 70MS 0medium plus 70mg L ?1hyg
1/2MSN Half-strength MS major salts,MS vitamins,0.5mg L ?1NAA,20g L ?1sucrose,2g L ?1gelrite,pH 5.81/2MSNH 50
1/2MSN medium plus 50mg L ?1hyg
?AS,acetosyringone;cef,cefotaxime;hyg,hygromycin;MS,Murashige and Skoog (1962);NAA,naphthaleneacetic acid;2,4-D,2,4-dichlorophenoxy acetic acid;6-BA,6-benzyladenine.
2000).After cocultivation,the calli were rinsed thoroughly the introduced transgenes were stably integrated into the rice with 500mg L ?1cefotaxime (Dingguo,Beijing)in 0.1M sterile genome.Leaves from nontransformed control plants and rep-mannitol solution.The inoculated calli were first placed onto resentative T 1plants of seven lines were ground in liquid N N 6D 2–CH 25(Table 1)for 2wk and then transferred onto N 6D 2–by using a mortar and pestle.Rice genomic DNA was isolated CH 50(Table 1)for further selection for 2to 3wk.Colonies by a CTAB (cetyltrimethylammonium bromide)method mod-of cells that had proliferated on the selection media were ified from Murray and Thompson (1980).Fifteen micrograms transferred onto a regeneration medium,RE 1–CH 50(Table 1),of genomic DNA was digested overnight with Bgl II and elec-and inoculated at 26?2?C under a 16-h photoperiod for shoot trophoresed on 0.8%agarose gels.Gels were blotted by capil-development.Regenerated shoots were further transferred to lary transfer with 20?SSC (standard saline citrate)on Hybond RE 2–CH 50(Table 1)for full plantlet formation and then rooted N ?nylon membrane (Amersham Pharmacia,UK).The three on 1/2MSNH 50(Table 1).Rooted plantlets were transferred PCR products mentioned above were each labeled with DIG-to soil in pots and grown to maturity in a greenhouse (28?C High Prime (digoxigenin;Roche Applied Science,Penzberg,day/25?C night)with a supplemental photoperiod of 10h Germany).The DNA probe preparation,hybridization,wash-(photo flux density of 280?mol m ?2s ?1).
ing,and detection were performed according to the instruction manual (Roche Applied Science,2003).
Polymerase Chain Reaction Analysis
Genomic DNA was isolated from rice leaves of transgenic Northern Blot Analysis
lines according to procedures described by Murray and For northern blot analysis,total RNA was isolated from Thompson (1980).Each PCR reaction mixture contained pistils (stigma together with style,within 48h before or after 1?g genomic DNA,5?L 10?Taq DNA polymerase buffer,anthesis)and developing kernels (5?15d after flowering)of 200?M of each deoxyribonucleotide (dNTP),25pmol of each representative T 1plants with a total RNA isolation kit primer,and 0.5U Taq DNA polymerase (Sangon,Shanghai,(RNAex Reagent and Systems,Watson,Shanghai,China)us-China)in a total volume of 50?L.The reaction mixture was ing the manufacturer’s instructions.The RNAs were quanti-overlaid with 50?L of mineral oil.The following primers fied spectrophotometrically by absorbance at 260nm.Twenty were used:micrograms of RNA per sample were electrophoresed on (1)5?CACCCAAGCGTGGTGATGTGGAG3?,formaldehyde 1.0%(w/v)agarose gels.The RNA was blotted (2)5?TCCCTGCTGCGGTTTTTCACCGAAG3?,by capillary transfer with 20?SSC on Hybond N ?nylon mem-(3)5?GTAGATCTGAGGGTAAATTTCTAG3?,brane (Amersham Pharmacia,UK).The DIG-labeled DNA (4)5?ATTTCACGTTCTACAGGACGGACG3?,probes were the same as those used for southern blotting,(5)5?CCTGACGTTACAACCCATCGCTCG3?,
and the hybridization,washing,and detection were performed (6)
5?GTCGATATAAGGTTTAGAAACCAGATC3?.
according to the instruction manual (Roche Applied Science,Primers 1and 2hybridize to the VHb gene sequence to pro-2003).
duce a 600-bp product,primers 3and 4hybridize to the tzs gene sequence to produce a 240-bp product,and primers 5Hygromycin Selection and and 6hybridize to the EPSPS gene sequence to produce a ?-D-Glucuronidase Screening
600-bp product.The PCR conditions for primer pairs 1/2and 3/4were genomic DNA denaturation at 94?C for 5min,fol-Selfed seeds of the transformants were sown on solidified lowed by 30amplification cycles (1min 30s at 94?C,1min MS 0H 70(Table 1)and cultured at 25?1?C.Hygromycin resis-at 58?C,and 1min at 72?C),and then elongation at 72?C for tance was scored 7to 10d after sowing by determining segrega-10min using a DNA Thermal Cycle480(Perkin-Elmer Corp.,tion of the selectable marker gene in T 1progeny.Resistant Norwalk,CT).For primer pair 5/6,the same PCR conditions seeds germinated normally on the selection medium,unlike were used except that the annealing temperature was changed susceptible seeds.
to 55?C.All PCR products (amplified from the coding region Segments of rice tissues were incubated in a buffer con-of their respective genes)were also used as probes for the taining 50m M phosphate,50m M disodium EDTA,0.5m M southern and northern blot analyses described below.
each of potassium ferro-and ferri-cyanide,0.1%(w/v)X-gluc (5-bromo-4-chloro-3-indolyl-?-D-glucuronide),and 0.1%Southern Blot Analysis
(w/v)Triton X-100,as described by Jefferson (1987)except that 20%(w/v)methanol was added to eliminate the endoge-Southern blot analysis was performed on T 1progeny from selected hyg-tolerant and PCR-positive events to confirm that
nous ?-D-glucuronidase (GUS)activity,at 37?C in the dark
R e p r o d u c e d f r o m C r o p S c i e n c e . P u b l i s h e d b y C r o p S c i e n c e S o c i e t y o f A m e r i c a . A l l c o p y r i g h t s r e s e r v e d .
CAO ET AL.:AGROBACTERIUM -MEDIATED MULTIPLE GENE TRANSFORMATION
2209
Table 2.Transformation efficiency mediated by Agrobacterium tumefaciens in four different rice cultivars.
Transformation No.of efficiency No.of cocultivated
No.of Hgy r calli producing No.of Hgy r
Rice cultivar
calli (A)
calli (B)
plants (C)
plants
B/A
C/A
%
Qiufeng 782615553186778.670.7Xiushui-11855632449173273.952.5Hanfeng 24314010949457.644.9Youfeng 206634212930.620.4Total
2086
1450
1153
4222
60.2
47.1Hgy r ,hygromycin-resistant.
for 2h to overnight.All green tissues were placed in 70%eration)showed a normal phenotype and were com-alcohol to remove chlorophyll for visualization.
pletely fertile (Fig.2A–D).
Stable Integration of Transgenes
Herbicide Tolerance
The integration of the three transgenes of interest,VHb ,To test for herbicide tolerance,a water solution of 5.0m M tzs ,and the modified EPSPS gene,into the rice genome
glyphosate and 0.1%(v/v)Tween 20(polyoxyethylene sorbi-tan monolaurate)was placed on both sides of the leaves of T 0and T 1plants when they were approximately 61cm tall.Alternatively,plantlets at the three-leaf stage were sprayed with 0.036L ha ?1glyphosate formulation (360g a.i.L ?1)with the equivalent of 13g ha ?1glyphosate.All the plantlets follow-ing glyphosate treatment were scored for tolerance after 2wk.
Segregation Analysis for Hygromycin
Phosphotransferase Gene and ?-D-Glucuronidase Screening
A half-seed test was performed to determine the segrega-tion pattern of hpt (hygromycin phosphotransferase gene)and gus in T 1progeny.Seeds from T 0plants (self-pollinated)were cut into two halves,the half containing the embryo was sur-face-sterilized and germinated on MS 0H 70medium containing 70mg L ?1hyg,and the other half was histochemically stained for GUS expression.Data were analyzed by chi-square tests for goodness-of-fit to the expected ratios.
Analysis of Growth Performance and Productivity
To assess the effects of VHb and tzs expression on the growth performance and productivity of transgenic rice,field experiments were conducted at the Crop Breeding and Culti-vation Research Institute,Shanghai (31?14?N,121?29?E,4m altitude).Panicle initiation date,complete heading date,ripen-ing date,plant height,panicle length,total grains per panicle,filled grains per panicle,seed-setting rate,and 1000-grain weight were measured on populations of transgenic plants,which were hyg resistant,glyphosate tolerant,and morphologi-cally identical.The data were statistically analyzed and proba-bility values were estimated using the Student’s t
test.
Fig.2.Rice transformation mediated by Agrobaterium tumefaciens EHA105/pYP1203E and the results of GUS (?-D-glucuronidase)his-RESULTS
tochemical analysis and herbicide-resistance test of transgenic rice plants.(A)Regenerated resistant shoots on RE 2–CH 50medium.(B)Production of Phenotypically Normal and Fertile
Regenerated shoots and roots on 1/2MSNH 50medium (Left is the Transgenic Rice Plants
nontransformed control shoots).(C)Transgenic plants carrying the five transgenes putatively growing in soil in the greenhouse.(D)T 1A total of 1153putative transgenic lines,including progeny of transgenic Qiufeng carrying the five transgenes.(E)The 553transformants of Qiufeng,449of Xiushui-11,109roots and leaf of transgenic rice plants and the hygromycin-resistent calli (right)compared with the nontransformed control (left).(F)The of Hanfeng,and 42of Youfeng,were regenerated.Trans-leaves of transgenic rice plants (right)and the nontransformed control formation efficiency ranged from 70.7%(Qiufeng)to (left)after daubing with 5.0m M glyphosate solution.(G)Transgenic 20.4%(Youfeng),with an average of 47.1%(Table 2).plants (right)and the nontransformed control (left)after spraying with the equivalent of 13g ha ?1glyphosate.
Most of the independent primary transformants (T 0gen-
R e p r o d u c e d f r o m C r o p S c i e n c e . P u b l i s h e d b y C r o p S c i e n c e S o c i e t y o f A m e r i c a . A l l c o p y r i g h t s r e s e r v e d .
2210
CROP SCIENCE,VOL.44,NOVEMBER–DECEMBER 2004
Table 3.The cointegration analysis of the transgenes in T 0plants (hygromycin-resistant)by polymerase chain reaction assay.
No.of T 0lines containing VHb /tzs /EPSPS
Total no.of T 0Cultivar ?/?/???/?/??/?/??/?/??/?/??/?/??/?/??/?/?lines Cointegration
%Xiushui-112600002012990.2Qiufeng 3900020114389.7Hanfeng 2400010102690.7Youfeng 1300001011592.3Total
102
3
3
2
3
113
90.2
?Amplified DNAs were present (?)or absent (?).
was verified by PCR and southern blot analysis.One genes (Table 4),indicating that the two transgenes were linked tightly at one or possibly two integration sites.hundred thirteen transgenic lines (43transformants of Qiufeng,29of Xiushui-11,26of Hanfeng,and 15of You-Leaves of putative T 0plants remained green,while those of control plants turned yellow following glypho-feng)were selected for PCR assay (Table 3and Fig.3).Among the 113independent transformants (Hyg r ),102sate treatment (Fig.2F).When sprayed with glyphosate,nontransformed plants were killed at the spray rate of (90.2%)carried all three genes.A total of 72T 1plants from six independent lines were used in southern blot 13g ha ?1glyphosate,while all putative T 0plants that regenerated on hyg selection medium exhibited toler-analysis.Results confirmed the integration and inheri-tance of the foreign genes in the rice genome (Fig.4).ance to glyphosate (Fig.2G).The tolerance to suscepti-ble ratio of four independent events (Q6,X6,H6,and The T 1plants,including two representative lines of Xiu-shui-11(X-1-1and X-2-9),two lines of Qiufeng (Q-1-5Y6)fit a 3:1ratio,confirming that the modified EPSPS gene was inherited in a simple Mendelian fashion (Ta-and Q-2-1),one line of Hanfeng (H-1-1),and one line of Youfeng (Y-1-1),contain a low copy number (1?3ble 5).
Fifty-five T 1plants (each from an independent trans-copies)of the transgenes.The cointegration frequency (90.2%)and the southern blot analysis provide evidence genic event)that were hyg resistant were analyzed for expression of VHb and tzs by northern blot assays (Fig.that the three transgenes of interest were integrated as linked sequences at the same locus.
5).Four T 1transgenic rice lines (X-1-1,Q-2-5,H-1-1,and Y-1-1)expressed VHb ,while no expression was found in the nontransformed control plants (Fig.5A).We con-Expression of Transgenes
firmed that tzs under the pistil-specific promoter STS14The gus gene was highly expressed in the hyg-resistant was expressed highly in the pistil of transgenic plants,
calli and in the transgenic rice plants (Fig.2E).The half-seed test showed that T 1progeny from eight indepen-dent transformants,X4,X5,Q3,Q11,H13,H16,Y3,and Y8,fit a 3:1ratio or a 15:1ratio for hpt and
gus
Fig.4.Southern blot analysis of T 1transgenic rice https://www.doczj.com/doc/dd17184906.html,ne:P,5ng plasmid pYP1203E DNA cut by Bgl II at a single site was loaded as a positive control;C,a nontransformed control plant;X-1-1,X-2-9,Q-1-5,Q-2-1,H-1-1,and Y-1-1,representative T 1
transgenic Fig.3.Polymerase chain reaction analysis of VHb (Vitreoscilla hemo-plants from their T 0progenies respectively (Plant genomic DNA digested with Bgl II.X stands for ‘Xiushui-11’,Q for ‘Qiufeng’,H globin gene),tzs (trans -zeatin secretion gene),and EPSPS (5-enol-pyruvylshikimate-3-phosphate synthase)in T 0rice https://www.doczj.com/doc/dd17184906.html,nes:M,for ‘Hanfeng’,and Y for ‘Youfeng’).The three polymerase chain reaction products were used as probes and labeled with DIG-Prime molecular weight marker (A)and (C)DL2000,(B)?X174Hae III digest;P,positive control (amplified fragments from plasmid (digoxigenin;Roche Applied Science,Penzberg,Germany).The same southern filter was rehybridized with different probes.(A)pYP1203E);C,a nontransformed control plant;X-1and X-2,puta-tive T 0plants of ‘Xiushui-11’;Q-1and 2,putative T 0plants of VHb ,Vitreoscilla hemoglobin gene;(B)tzs ,trans -zeatin secretion gene;(C)EPSPS ,5-enolpyruvylshikimate-3-phosphate synthase ‘Qiufeng’;H-1,putative T 0plants of ‘Hanfeng’;Y-1,putative T 0plants of ‘Youfeng’.
gene.
R e p r o d u c e d f r o m C r o p S c i e n c e . P u b l i s h e d b y C r o p S c i e n c e S o c i e t y o f A m e r i c a . A l l c o p y r i g h t s r e s e r v e d .
CAO ET AL.:AGROBACTERIUM -MEDIATED MULTIPLE GENE TRANSFORMATION
2211
Table 4.Segregation analysis of hpt and gus in T 1plants.
Expected Transformants Hyg r /GUS ?
Hyg r /GUS ?
Hyg s /GUS ?
Hyg s /GUS ?
Total ratio ?2P value?X4351015513:10.167?0.50X5330012453:10.067?0.75Q3380011493:10.061?0.75Q11450214613:10.056?0.75H132********:10.022?0.75H1617006233:10.014?0.90Y328008363:10.037?0.75Y8
22
9
31
3:1
0.097
?0.75
Hgy r ,hygromycin-resistant;Hyg s ,hygromycin-susceptible;GUS ?,GUS-positive;GUS ?,GUS-negative.
?P values (1df)greater than 0.05indicate that observed values were not significantly different from expected values.
while no expression was observed in the seed of the trans-DISCUSSION
genic plants and the nontransformed control (Fig.5B).Using Agrobacterium -mediated gene transfer,a large Twenty hyg-resistant and GUS-positive T 1plants (each segment of DNA can be delivered to plants (Hamilton from an independent transgenic event)were selected et al.,1996),and linking multiple genes in a single plas-to assay for the coexpression of all transgenes.Out of mid is technically possible.In our study,we constructed the 20plants,17(85%)expressed all five transgenes.the binary vector pYP1203E (21.7kbp),which harbored However,X-6-2did not express tzs ;H-5-9lacked ex-three genes of interest,in addition to a selectable marker pression of VHb ;and Q-3-4did not express VHb ,tzs ,gene and a reporter gene,as linked expression cassettes or EPSPS .
in the T-DNA region.The advantages of this method are that the different transgenes are frequently inserted into the same locus,and that a single selectable marker is Enhanced Shoot Growth and Seed Productivity
used.It has been observed that the presence of multiple On the basis of the cointegration and coexpression copies of the same promoter within a transgenic plant of the transgenes,most transgenic families were consid-often results in transcriptional silencing of the trans-ered to be useful in a breeding program.Field experi-genes (Matzke and Matzke,1998).To avoid transcrip-ments were conducted to measure various parameters tional silencing of the transgenes,we used different pro-(Table 6).Plant height,panicle length,the number of moters for each of the expression cassettes.Moreover,total grains per panicle,and the number of filled grains matrix attachment regions (MARs)or scaffold attach-per panicle were significantly increased in T 2lines of ment regions (SARs)have been reported to increase 23-1and 63-50(Qiufeng);18-34(Xiushui-11);20-5(Han-overall levels of expression and decrease variability of feng);and 1-3and 25-18(Youfeng),as compared with expression (Allen et al.,1996,2000;Spiker and Thomp-the nontransformed counterparts (Table 6).There were son,1996;Ulker et al.,1999).Here,SAR68,a chromo-no obvious differences in seed-setting rate and 1000-some MAR of tobacco (SAR68)was used in our vector grain weight between control and most transgenic lines construction (Fig.1)to enhance the expression of the except 23-1(Qiufeng)and 25-18(Youfeng),where a transgenes.Our results confirmed that the vector trans-significant increase was observed in 1000-grain weight,ferred the transgenes into the plant’s genome efficiently as compared with the control (Table 6).The number of and ensured their successful expression.
total grains per panicle,and the number of filled grain Enhancing crop productivity is a fundamental objec-per panicle significantly increased in line 19-7(Xiushui-tive of agriculture.Oxygen,as a limiting factor in plant 11)compared with the control,although plant height,productivity,along with other environmental factors such panicle length,seed-setting rate,and 1000-grain weight as sunlight,water,mineral nutrients,and carbon diox-were lower than the control (Table 6).Finally,no signifi-ide,can place constrains on plant metabolism.Research cant differences in the parameters studied were found has focused on optimizing the plant’s abilities to effec-between line 54-13(Qiufeng)and the control (Table 6).tively utilize these resources.Holmberg et al.(1997)gen-Moreover,no significant differences in the growth phases erated tobacco plants that synthesize the VHb hemoglo-from transplanting to panicle initiation and then to com-bin and demonstrated that these transgenic plants had plete heading and ripening were found in any of the lines increased productivity compared with their nontrans-formed counterparts.The mechanism by which the VHb
studied (data not shown).
Table 5.Segregation analysis of the modified EPSPS gene in T 1plants.
Total Segregation
Expected Transformants T 1lines (tolerant/susceptible)?
ratio ?2P value?Q63424/103:10.157?0.50X63830/83:1 1.404?0.10H64535/103:10.067?0.75Y6
26
21/5
3:1
0.205
?0.50
?Tolerant or susceptible to 5m M glyphosate.
?P values (1df)greater than 0.05indicate that observed values were not significantly different from expected values.
R e p r o d u c e d f r o m C r o p S c i e n c e . P u b l i s h e d b y C r o p S c i e n c e S o c i e t y o f A m e r i c a . A l l c o p y r i g h t s r e s e r v e d .
2212
CROP SCIENCE,VOL.44,NOVEMBER–DECEMBER 2004
introduced into plants to enhance the endogenous cyto-kinin content in tissues.In combination with an increase in cytokinin level,the transgenic plants often have higher growth rates and enhanced productivity.
In our study,rice plants transformed with both VHb and tzs displayed statistically significant increases in plant height and panicle length compared with the non-transformed controls.The results are consistent with find-ings of Holmberg et al.(1997)in that transgenic tobacco plants expressing VHb exhibited enhanced growth.We also found increases in the numbers of total grains per panicle and filled grains per panicle,and these results are consistent with findings of Roeckel et al.(1998)in that transgenic oilseed rape expressing tzs showed increased seed numbers per silique.Unexpected modifications of some agronomic traits were found.For example,no sig-nificant differences in any of the parameters studied were found between line 54-13(Qiufeng)and the control.Additionally,seed-setting rate and 1000-grain weight were not modified in several of the transgenic plants.These phenotypic alterations may be further explained by detailed analysis of different factors known to affect growth,including endogenous and environmental factors.Because weeds are a great menace in rice
plantations,and herbicides are considered the most efficient way to Fig.5.Northern analysis of the expression of VHb (Vitreoscilla he-moglobin gene)and tzs (trans -zeatin secretion gene)in T 1plants.control weeds in rice,we sought to produce glyphosate-Lanes:X-1-1(k),Q-2-1(k),H-1-1(k),and Y-1-1(k)in (A)and (B)tolerant rice.In our study,the modified EPSPS gene was were loaded with 20?g total RNA from kernels of T 1plants;Lanes:expressed in rice and the product protein was targeted to X-1-1(p),Q-2-1(p),and H-1-1(p)in (B)were loaded with 20?g total RNA from pistils of T 1plants;Lanes:C(k)and C(p)were the rice chloroplast by a chloroplast-targeting transit loaded with 20?g total RNA from kernels and pistils of nontrans-peptide sequence from RBCS.The transgenic rice plants formed control respectively.X stands for ‘Xiushui-11’,Q for ‘Qiu-had high levels of tolerance to glyphosate when sprayed feng’,H for ‘Hanfeng’,and Y for ‘Youfeng’.
at the rate of 5.0m M or 13g ha ?1.
In summary,our study showed that multiple foreign functions in the tobacco system is thought to be through genes of agronomic importance,as linked expression a combination of increased availability of O 2as a sub-cassettes within a single vector,can be introduced into strate for cellular metabolism and by increased O 2lead-the plant genome through Agrobacterium-mediated trans-ing to higher levels of ATP available for powering cellu-formation.The transgenic rice plants displayed increased lar metabolism.It is also possible that the hemoglobin productivity and enhanced tolerance to the herbicide scavenges free O 2and its radicals,thus protecting the glyphosate,although more detailed studies involving cell from these harmful molecules.
prolonged expression and inheritance of the transgenes,Cytokinins are involved in aspects of plant growth along with traditional breeding progress,must be done and development.The ipt gene or tzs gene from the plant pathogenic bacterium A.tumefaciens have been
to obtain a new plant type with increased yield potential.
Table 6.Effects of VHb and tzs expression on T 2rice growth and productivity.?
No.of total grains No.of filled grains Seed-setting
1000-grain Cultivar Line Plant height?
Panicle length§
per panicle§
per panicle§rate§weight?cm
%g Qiufeng
23-199.2?1.5**20.0?1.3**168.9?2.1**162.3?1.7**96.9?2.329.3?1.6*54-1394.8?3.117.2?2.4143.9?3.5138.0?2.496.5?2.625.9?2.663-50107.9?2.0**19.5?1.9**231.1?2.6**225.6?3.0**97.7?2.428.4?1.9control 92.4?0.716.9?0.4142.5?1.0135.7?0.895.2?1.326.4?0.9Xiushui-1118-34108.0?1.9**19.3?2.1104.3?1.4**100.6?1.2**96.5?1.630.6?1.719-799.9?2.518.6?3.1118.1?2.9**109.4?3.3**92.6?2.529.1?2.2control 101.0?1.418.7?0.996.8?1.693.5?1.296.4?2.029.3?0.8Hanfeng 20-593.8?1.2**17.9?1.0*184.5?1.9**177.8?2.2**96.4?2.527.3?1.1control 86.1?1.016.3?0.8136.9?1.6132.0?1.996.4?1.726.4?0.9Youfeng
1-3105.4?1.0**19.5?1.5**179.7?1.4**177.8?2.0**98.4?1.226.2?1.525-18111.2?1.1**20.1?0.9**225.2?1.2**219.9?1.6**98.9?0.927.7?1.4*control
94.5?0.9
18.3
?1.3
144.5
?1.1
141.4
?1.5
97.9?
1.3
25.5
?0.7
?Values are expressed as mean ?SD.?Each value is a mean of 5plants,n ?5.
§Each value is mean of 5plants (at least 5different panicles of each plant were examined),n ?5.For each rice line,the same 5plants were analyzed.*Significant differences at the P ?0.05level between control and transgenic plants in the same column.**Significant differences at the P ?0.01level between control and transgenic plants in the same column.
R e p r o d u c e d f r o m C r o p S c i e n c e . P u b l i s h e d b y C r o p S c i e n c e S o c i e t y o f A m e r i c a . A l l c o p y r i g h t s r e s e r v e d .
CAO ET AL.:AGROBACTERIUM -MEDIATED MULTIPLE GENE TRANSFORMATION
2213
transformation and regeneration of rice mediated by Agrobacte-ACKNOWLEDGMENTS
rium.Acta.Bot.Sin.42:1172–1178.
The authors thank Dr.H.Q.Yang,H.W.Xue,H.L.An,R.Jefferson,R.A.1987.Assay chimeric genes in plants:The GUS gene fusion system.Plant Mol.Biol.Rep.5:387–405.
Xie,and Y.Z.Wang for technical assistance and encouragement.Ma,Q.H.,Z.B.Lin,and D.Z.Fu.2002.Increased seed cytokinin levels The research was supported by grants from the National High in transgenic tobacco influence embryo and seeding development.Science and Technology Program of China (863-2001AA212251).
Funct.Plant Biol.29:1107–1113.
Matzke,A.J.M.,and M.A.Matzke.1998.Position effects and epi-REFERENCES
genetic silencing of plant genes.Curr.Opin.Plant Biol.1:142–148.Mckenzie,M.J.,V.Mett,P.H.S.Reynolda,and P.E.Jameson.1998.Allen,G.C.,G.Hall,S.M.W.Newman,S.Spiker,A.K.Weissinger,Controlled cytokinin production in transgenic tobacco using a cop-and W.F.Thompson.1996.High-level transgene expression in plant per-inducible promoter.Plant Physiol.116:969–977.
cells:Effects of a strong scaffold attachment region from tobacco.Murashige,T.,and F.Skoog.1962.A revised medium for rapid growth Plant Cell 8:899–913.
and bioassays with tobacco tissue cultures.Physiol.Plant.15:473–Allen,G.C.,S.Spiker,and https://www.doczj.com/doc/dd17184906.html,e of matrix 497.
attachment regions (MARs)to minimize transgene silencing.Plant Murray,M.G.,and W.F.Thompson.1980.Rapid isolation of high Mol.Biol.43:361–376.
molecular weight plant DNA.Nucl.Acid Res.8:4321–4325.
Bizily,S.P.,C.L.Rugh,and R.B.Meagher.2000.Phytodetoxification Peeters,K.,C.Wilde,and A.Depicker.2001.Highly efficient targeting of hazardous organomercurials by genetically engineered plants.and accumulation of a Fab fragment within the secretory pathway Nat.Biotechnol.18:213–217.
and apoplast of Arabidopsis thaliana.Eur.J.Biochem.268:4251–Campbell,B.T.,P.S.Baenziger,A.Mitra,S.Sato,and T.Clemente.4260.
2000.Inheritance of multiple transgenes in wheat.Crop Sci.40:Ramandeep,K.W.Hwang,M.Raje,K.J.Kin,B.C.Stark,K.L.Dikshi,1133–1141.
and D.A.Webster.2001.Vitreoscilla Hemoglobin:Intracellular Comai,L.,D.Facciotti,W.R.Hiatt,G.Thompson,R.E.Rose,and localization and binding to membranes.J.Biol.Chem.276:24781–D.M.Stalker.1985.Expression in plants of a mutant aro A gene 24789.
from Salmonella typhimurium confers tolerance to glyphosate.Na-Roche Applied Science.2003.DIG-High Prime DNA Labeling and ture (London)317:741–744.
Detection Starter Kit II [Online].Available at http://www.roche-Comai,L.,L.Sen,and D.M.Stalker.1983.An altered aro A gene https://www.doczj.com/doc/dd17184906.html,/pack-insert/1585614a.pdf [verified 11June product confers resistance to the herbicide glyphosate.Science 2004].Roche Applied Science,Penzberg,Germany.
(Washington,DC)221:370–371.
Roeckel,P.,T.Oancia,and J.R.Drevet.1998.Phenotypic alterations Eldik,G.J.V.,M.Wingens,R.K.Ruiter,M.M.A.V.Herpen,J.A.M.and component analysis of seed yield in transgenic Brassica napus Schtauwen,and G.J.Wullems.1996.Molecular analysis of a pistil-plants expressing the tzs gene.Physiol.Plant.102:243–249.
specific gene expressed in the stigma and style cortex of Solanum Slater,S.,T.A.Mitsky,K.L.Houmiel,M.Hao,S.E.Reiser,N.B.tuberosum.Plant Mol.Biol.30:171–176.
Taylor,M.Tran,H.E.Valentin,D.J.Rodriguez,D.A.Stone,S.R.Fillatti,J.A.J.,J.Kiser,R.Rose,and https://www.doczj.com/doc/dd17184906.html,ia.1987.Efficient transfer Padgette,G.Kishore,and K.J.Gruys.1999.Metabolic engineering of glyphosate tolerance gene into tomato using a binary Agrobacte-of Arabidopsis and Brassica for poly(3-hydroxybutyrate-co-3-hydrox-rium tumefaciens vector.Bio/technology 5:726–730.
yvalerate)copolymer production.Nat.Biotechnol.17:1011–1016.Halpin,C.,S.E.Cooke,A.Barakate,A.E.I.Amrani,and M.D.Ryan.Spiker,S.,and W.F.Thompson.1996.Nuclear Matrix attachment regions 1999.Self-processing 2A-polyproteins:A system for coordinate and transgene expression in plants.Plant Physiol.110:15–21.
expression of multiple proteins in transgenic plants.Plant J.17:Stalker,D.M.,W.R.Hiatt,and https://www.doczj.com/doc/dd17184906.html,ai.1985.A single amino acid 453–459.
substitution in the enzyme 5-endopyruvyshikimate-3-phosphate syn-Hamilton,C.M.,A.Frary,C.Lewis,and S.D.Tanksley.1996.Stable thase confers resistance to the herbicide glyphosate.J.Biol.Chem.transfer of intact high weight DNA into plant chromosomes.Proc.260:4724–4728.
https://www.doczj.com/doc/dd17184906.html,A 93:9975–9979.
Toriyama,K.,and K.Hinata.1985.Cell suspension and protoplast culture Heinemeyer,W.,I.Buchmann,D.W.Tonge,J.D.Windass,J.Alt-in rice.Plant Sci.41:179–183.
Moerbe,E.W.Weiler,T.Botz,and J.Schroder.1987.Two Agro-Ulker,B.,G.C.Allen,W.F.Thompson,S.Spiker,and A.K.Weissinger.bacterium tumefaciens genes for cytokinin biosynthesis:Ti plasmid-1999.A tobacco matrix attachment region reduces the loss of trans-coded isopentenyltransferases adapted for function in prokaryotic gene expression in the progeny of transgenic tobacco plants.Plant or eukaryotic cells.Mol.Gen.Genet.210:156–164.
J.18:253–264.
Hiei,Y.,S.Ohta,T.Komari,and T.Kumashiro.1994.Efficient trans-Wilde,C.D.,K.Peeters,A.Jacobs,I.Peck,and A.Depicker.2002.formation of rice mediated by Agrobacterium and sequence analysis Expression of antibodies and Fab fragments in transgenic potato of the boundaries of the T-DNA.Plant J.6:271–282.
plants:A case study for bulk production in crop plants.Mol.Holmberg,N.,G.Lilius,J.E.Bailey,and L.Buelow.1997.Transgenic Breed.9:271–282.
tobacco expressing Vitreoscilla hemoglobin exhibits enhanced Ye,X.D.,A.B.Salim,K.Andreas,J.Zhang,L.P.Lucca,P.Beyer,growth and altered metabolite production.Nat.Biotechnol.15:244–and I.Potrykus.2000.Engineering the provitamin A (beta-carotene)247.
biosynthetic pathway into (carotenoid-free)rice endosperm.Science (Washington,DC)287:303–305.
Huang,J.Q.,Z.M.Wei,H.L.An,S.P.Xu,and B.Zhang.2000.Efficient