Inhibition of TLR3-Mediated Proin?ammatory Effects by Alkylphosphocholines in Human Retinal Pigment Epithelial Cells
Markus Wo¨rnle,1,2Monika Merkle,2,3Armin Wolf,2,4Andrea Ribeiro,1
Susanne Himmelein,1Marcus Kernt,4Anselm Kampik,4and Kirsten H.Eibl-Lindner4
P URPOSE.To elucidate the role of Toll-like receptor3(TLR3)in the pathogenesis of age-related macular degeneration(AMD) and to investigate the effect of alkylphosphocholines(APCs) on the TLR3-mediated expression of cytokines and growth factors in human retinal pigment epithelial(RPE)cells.
M ETHODS.Con?uent cultures of human RPE cells(ARPE-19) were stimulated with poly(I:C)RNA as a well-established ligand for TLR3.Cytokine pro?les were determined by RT-PCR on the activation of TLR3.RPE cells were transfected with siRNA speci?c for TLR3and RIG-1to determine the receptors involved.The effect of preincubation of RPE cells with APCs on the expression level of target genes was assessed.
R ESULTS.Poly(I:C)RNA stimulation led to a dose-dependent increase in the expression of TLR3and RIG-I.A signi?cant increase in expression levels of IL-6,TNF-?,IL-8,MCP-1, ICAM-1,and BFGF was observed after poly(I:C)RNA stimula-tion(P?0.05).This effect was time and dose dependent.No effect on PEDG or VEGF expression was seen.Transfection of RPE cells with siRNA speci?c for TLR3reduced poly(I:C) RNA-induced mRNA expression of the genes(P?0.05).Pre-incubation of RPE cells with APCs signi?cantly reduced the poly(I:C)RNA-induced expression of the target genes(P?
0.05).
C ONCLUSIONS.The authors demonstrate that the expression of proin?ammatory cytokines and chemokines in RPE cells de-pends on the activation of TLR3.The induction of downstream gene expression is blocked by siRNA speci?c for TLR3and alkylphosphocholines.Therefore,TLR3should be considered a novel target in AM
D therapy.(Invest Ophthalmol Vis Sci.2011; 52:6536–6544)DOI:10.1167/iovs.10-6993I nnate immunity important for discriminating self-and non–self-antigens consists of the viral receptors Toll-like receptors(TLRs)and the alternative complement pathway. Both systems act as mediators between innate and adaptive immunity and can be activated as response to foreign anti-gens and in autoimmunity.In particular,TLR3recognizes the dsRNA of viral origin and polyriboinosinic/polyribocyt-idylic acid(poly(I:C)RNA),a synthetic analog of viral dsRNA.1TLR3is expressed on retinal pigment epithelial (RPE)cells,2which play a central role in local immune defense by acting as antigen-presenting cells and which express a variety of cytokines,chemokines,and growth factors.There is growing evidence of cross-talk between TLRs and complement pathways in that a regulatory role for complement in TLR-induced cytokine responses has been shown.3Adding on the potential impact of the expression of viral receptors,RP
E cells represent targets for different infectious agents,including viruses.Age-related macular de-generation(AMD)exempli?es the clinical relevance of these ?ndings.Two distinct forms of AMD are known:the“dry”atrophic form,characterized by RPE loss and formation of extracellular deposits called drusen in the central region of the retina,4and the“wet”neovascular form,characterized by new vessel formation from the choroid5mediated by an increased level of vascular endothelial growth factor(VEGF) in the aqueous.6The pathogenesis of AMD is supposed to be de?ned by chronic in?ammatory processes.However,mech-anisms initiating and perpetuating in?ammation remain to be elucidated.Drusen characteristic for early AMD contain cellular debris,structural proteins of RPE cells,and comple-ment components such as complement factor H(CFH).7 Furthermore,genetic variants of both TLR3and the key complement regulatory protein CFH have recently been found to confer protection against AMD.8,9Thus,TLR3and the complement system are considered to be relevant in the pathogenesis of AMD regardless of whether these compo-nents of innate immunity are activated by self-antigens or foreign antigens.This study was intended to analyze the expression regulation of TLR3and dependent cytokines and chemokines in RPE cells.In addition,the role of another viral receptor recognizing viral dsRNA,helicase retinoic acid-inducible gene I(RIG-I),was examined.10The selection of target genes was based on previous evidence for their relevance in acute and chronic in?ammatory processes and in the pathogenesis of AMD.Expression of CFH on RPE cells is known to be reduced by the proin?ammatory cytokines IL-6and TNF-?.11Furthermore,a systemic increase in the levels of the in?ammatory markers CRP and IL-6is indepen-dently associated with the progression of AMD.12Fibronec-tin fragments,which are associated with the development of degenerative diseases of ocular tissues,upregulate IL-6and MCP-1in RPE cells.13In addition,intraocular concentrations
From the Ludwig-Maximilians-University,1Medical Policlinic,De-partment of Internal Medicine,and4Department of Ophthalmology, Klinikum der Universita¨t Mu¨nchen,Campus Innenstadt,Munich,Ger-many;and3Klinikum Traunstein,Department of Internal Medicine, Traunstein,Germany.
2These authors contributed equally to the work presented here and should therefore be regarded as equivalent authors.
Supported by Freunde und Fo¨rderer der Augenklinik der Ludwig-Maximilians-Universita¨t Mu¨nchen(KE);Else Kro¨ner-Fresenius-Stiftung, Fritz-Bender-Stiftung,Deutsche Vereinigung zur Beka¨mpfung von Vi-ruskrankheiten(MW).
Submitted for publication December6,2010;revised March10 and May17,2011;accepted June20,2011.
Disclosure:M.Wo¨rnle,None;M.Merkle,None;A.Wolf,None;
A.Ribeiro,None;S.Himmelein,None;M.Kernt,None; A. Kampik,None;K.H.Eibl-Lindner,None
Corresponding author:Kirsten H.Eibl-Lindner,Ludwig-Maximil-ians-University,Department of Ophthalmology,Klinikum der Univer-sita¨t Mu¨nchen,Campus Innenstadt,Mathildenstrasse8,D-80336Mu-nich,Germany;kirsten.eibl@med.uni-muenchen.de.
Retina
of MCP-1and ICAM-1have been found to be elevated in AMD.14For IL-8,a promoter polymorphism has been asso-ciated with an increased risk for AMD.15Stimulation of RPE cells with amyloid?(A?),another constituent of drusen, upregulates proin?ammatory mediators such as IL-8.16 Concomitantly,in this work,a novel therapeutic option in blocking in?ammatory responses by alkylphosphocho-lines(APCs)was identi?ed.APCs are synthetic phospholipid derivatives that act as membrane-targeted drugs in?uencing signal transduction in proliferative ophthalmic,17–20neo-plastic,21and protozoal diseases.22They have been demon-strated to inhibit protein kinase C(PKC),mitogen-activated kinase(MAPK/p38),and protein kinase B(PI3K/AKT);lipid raft formation and inhibition of phosphatidylcholine synthe-sis are discussed as potential cell membrane targets.
M ATERIALS AND M ETHODS
Cell Culture
ARPE-19cells,a human RPE cell line,were purchased from the American Type Culture Collection(Manassas,VA)and were grown in a1:1mixture of DMEM and Ham’s F12medium(DMEM/Ham’s F12;Biochrome,Cam-bridge,UK),supplemented with10%FCS,penicillin(100U/mL),and streptomycin sulfate(100?g/mL).The ARPE-19cell line is well estab-lished in AMD research and arose spontaneously from primary RPE cells obtained from a human donor.Experiments were performed in accor-dance with the Declaration of Helsinki.The cells have a highly epithelial morphology and form the characteristic hexagonal monolayer.Cells were grown at37°C in a humidi?ed5%CO
2
atmosphere and were split twice a week when90%con?uence was reached.Cells were obtained at passage20 and used at passages22to29.Before experimental procedures,the ARPE-19 cells were kept under serum-free conditions for24hours. Alkylphosphocholines
An APC composed of a carbonyl chain with22C atoms bound to phosphocholine was synthesized and kindly donated by Hansjo¨rg Eibl (Max-Planck-Institute for Biophysical Chemistry,Go¨ttingen,Germany). The substance was of analytical grade,as determined by high-performance liquid chromatography.A stock solution of APC in phosphate-buffered saline(PBS;pH7.2)was prepared under sterile conditions at a concen-tration of1mM and was stored at4°C.Further dilutions were obtained in PBS,and PBS only served as a control for all subsequent experiments. Quantitative Reverse Transcriptase-Polymerase Chain Reaction Analysis
Quantitative RT-PCR analysis was conducted as described.23For quantitative RT-PCR,2?g isolated total RNA underwent random primed reverse transcription using a modi?ed Moloney murine leukemia virus reverse transcriptase(Superscript;Life Technolo-gies,Darmstadt,Germany).In parallel,2-?g aliquots were pro-cessed without reverse transcription to control for contaminating genomic DNA.Real-time RT-PCR was performed on a sequence detection system(TaqMan ABI7700;PE Applied Biosystems,Darm-stadt,Germany).GAPDH was used as a reference gene.All water controls were negative for target and housekeeper.Sequences with the following GenBank accession numbers served for the design of the predeveloped Taq Man assay reagents or primers and probe, purchased from Applied Biosystems:NM003265/U88879Seq AOD: TAGCAGTCATCCAACAGAATCATGAG(human TLR3);NM014314Seq AOD:GACCATGCAGGTTATTCTGGACTTT(human RIG-I);NM000600 (human IL-6),Hs00174128_m1,NM_000594,NM_000594,T:ATGTTG-TAGCAAACCCTCAAGCTGA(human TNF-?),Z11686(human IL-8); NM002982.3/M24545.1Seq AOD:TCAGCCAGATGCAATCAATGCCCCA (human MCP-1),NM_000201(human ICAM-1),AGCCAGGTAACGGT-Knockdown of Gene Expression with Short-Interfering RNA
Predesigned short-interfering RNA(siRNA)speci?c for TLR3and RIG-I were purchased from Ambion(Tokyo,Japan).Transfection of siRNA into the cells was performed using transfected agent(siPORT-NeoFX;Ambion),as previously described.24Scrambled siRNA was used as the nonspeci?c negative control of siRNA(Ambion).Cells were pretreated with siRNA for24hours and then washed once using cell culture medium to remove remaining transfection agent. Poly(I:C)RNA was mixed into the cell culture medium as indicated. Cell Death Assay
For analyses of the effect of APC and poly(I:C)RNA on the apoptosis of RPE cells,cells were incubated with culture medium with or with-out APC(2?M,4?M)for24hours and subsequently incubated with poly(I:C)RNA(5?g/mL)alone or in combination with APC(2?M,4?M)for12hours.The amount of dead cells was determined(Cell Death Detection ELISA kit;Roche,Basel,Switzerland)in accordance with the protocol provided by the company.
Statistical Analysis
Values are provided as mean?SD.Statistical analysis was performed by unpaired t-test if applicable or by ANOVA.Signi?cant differences are indicated for P?0.05and P?0.01,respectively.
R ESULTS
Effect of poly(I:C)RNA on the Expression of the Viral Receptors TLR3and RIG-I on Human
RPE Cells
First we tested the expression of the viral receptors TLR3 and RIG-I on human RPE cells under basal and proin?amma-tory conditions.To simulate a proin?ammatory milieu in vitro,the cytokines IFN-?,TNF-?,and IL-1?were chosen. RPE cells were incubated without and with the cytokines IFN-?(20ng/mL),TNF-?(25ng/mL),and IL-1?(10ng/mL) alone or in combination for24hours.Expression of TLR3 and RIG-I was analyzed by real-time RT-PCR.RPE cells showed a basal expression of TLR3that was not signi?cantly in?uenced by any of the cytokines alone.The cytokine combination led to a strong increase in TLR3expression (Fig.1A).Basal expression of RIG-I was signi?cantly in-creased by IFN-?,TNF-?,and the combination of the cyto-kines,with the latter having the most pronounced effect (Fig.1B).Given that RPE cells exhibit a basal expression of the viral receptors TLR3and RIG-I and poly(I:C)RNA can act as a ligand for these receptors,we tested whether the expression of TLR3and RIG-I could be in?uenced by poly (I:C)RNA.RPE cells were stimulated with the synthetic analog of viral RNA,poly(I:C)RNA(10?g/mL),for different time intervals(3,6,9,12,24hours)RT-PCR showed a basal expression of the viral receptors TLR3and RIG-I that did not change signi?cantly over incubation time.TLR3expression was increased on stimulation of RPE cells with poly(I:C) RNA for6hours and a maximal expression level reached after24hours of poly(I:C)RNA stimulation(Fig.1C).RPE cells showed a comparable increase in RIG-I expression after 6,9,12,and24hours of poly(I:C)RNA stimulation(Fig. 1D).Next,RPE cells were stimulated without and with different concentrations of poly(I:C)RNA(0.5,5,10?g/ mL)for12hours,and the expression of TLR3and RIG-I was analyzed by RT-PCR.Poly(I:C)RNA stimulation led to a dose-dependent increase in the expression of TLR3and
IOVS,August2011,Vol.52,No.9Cytokine Pro?le and Alkylphosphocholines6537
Effect of poly(I:C)RNA on Cytokine and Chemokine mRNA Levels on Human RPE Cells were stimulated with poly(I:C)RNA(10?g/mL)for different time intervals(3,9,12,24hours)and with different concen-trations of poly(I:C)RNA(0.5,5,10?g/mL)for12hours,and
F IGURE1.Effect of poly(I:C)RNA on the expression of the viral receptors TLR3and RIG-I in human RPE cells.RPE cells were cultivated under basal conditions(basal)or stimulated with the proin?ammatory cytokines IFN-?(20ng/mL),TNF-?(25ng/mL),or IL-1?(10ng/mL) alone or in combination(comb)for24hours.Expression of TLR3and RIG-I was analyzed by RT-PCR.(A)Basal expression of TLR3was not signi?cantly in?uenced by IFN-?,TNF-?,or IL-1?alone but was strongly increased by the combination of these cytokines.(B)Basal expression of RIG-I was signi?cantly increased by IFN-?and TNF-?stimulation as well as the combination of the cytokines,which led to the strongest increase in RIG-I expression.RPE cells were stimulated without(basal)and with poly(I:C)RNA(10?g/mL)for different time intervals(3,6,9,12,24hours),and the expression of TLR3and RIG-I was analyzed by RT-PCR.RPE cells showed a basal expression of TLR3 that was increased by poly(I:C)RNA stimulation after6,9,12,and24hours,with a maximum at24hours of poly(I:C)RNA stimulation (C).RPE cells showed a comparable increase in RIG-I expression after6,9,12,and24hours of poly(I:C)RNA stimulation,and no increase in RIG-I expression was observed after3hours of poly(I:C)RNA stimulation(D).Next RPE cells were stimulated without(basal)and with different concentrations of poly(I:C)RNA(0.5,5,10,?g/mL)for12hours,and the expression of TLR3and RIG-I was analyzed by RT-PCR. Poly(I:C)RNA stimulation led to a dose-dependent increase in the expression of TLR3(E)and RIG-I(F),with a maximum under10?g/mL poly(I:C)RNA stimulation.Results are mean?SD of three incubations for each condition.rRNA served as the reference https://www.doczj.com/doc/bb15611511.html,parable results were obtained in two series of independent experiments.*P?0.05,**P?0.01.
6538Wo¨rnle et al.IOVS,August2011,Vol.52,No.9
IOVS,August2011,Vol.52,No.9Cytokine Pro?le and Alkylphosphocholines6539
F IGURE2.Effect of poly(I:C)RNA on cytokine and chemokine mRNA levels in human RPE cells.RPE cells were stimulated without(basal)and with poly(I:C)RNA(10?g/mL)for different time intervals(3,9,12,24hours),and the expression of IL-6(A),TNF-?(C),IL-8(E),and MCP-1(G) was analyzed by RT-PCR.Poly(I:C)RNA stimulation led to a time-dependent increase in mRNA expression of these genes.After24hours of poly (I:C)RNA stimulation,gene expression decreased again but was still signi?cantly elevated for IL-6and MCP-1.Stimulation with different concentrations(0.5,5,10?g/mL)of poly(I:C)RNA for12hours led to a dose-dependent increase in IL-6(B),TNF-?(D),IL-8(F),and MCP-1(H)
increase in mRNA expression of the genes,reaching a maxi-mum after12hours;expression levels of IL-6and MCP-1were still signi?cantly elevated after24hours of poly(I:C)stimula-tion.Stimulation with different concentrations of poly(I:C) RNA(0.5,5,10?g/mL)for12hours led to a dose-dependent increase in IL-6,TNF-?,IL-8,and MCP-1expression with a maximum under10?g/mL poly(I:C)RNA stimulation(Fig.2).Effect of poly(I:C)RNA on mRNA Levels of
ICAM-1,BFGF,PEDG,and VEGF on Human
RPE Cells
Furthermore,the expression of mediators important for the adhesion of in?ammatory cells,?brosis,and vascular growth were analyzed.RPE cells were stimulated with poly
(I:C) F IGURE3.Effect of poly(I:C)RNA on mRNA levels of ICAM-1,BFGF,PEDG,and VEGF in human RPE cells.RPE cells were stimulated without (basal)and with poly(I:C)RNA(10?g/mL)for different time intervals(3,9,12,24hours),and expression of ICAM-1(A),BFGF(C),PEDG(E), and VEGF(F)was analyzed by RT-PCR.ICAM-1expression was increased by poly(I:C)RNA after3,9,12,and24hours of stimulation time.The maximum increase was observed after12hours of stimulation(A).BFGF expression was increased by poly(I:C)RNA after9,12,and24hours, with a maximum after12hours of stimulation time(C).Poly(I:C)RNA had no effect on the basal expression of PEDG(E)and VEGF(F).Stimulation with different concentrations(0.5,5,10?g/mL)of poly(I:C)RNA for12hours led to a dose-dependent increase in ICAM-1(B)and BFGF(D) 6540Wo¨rnle et al.IOVS,August2011,Vol.52,No.9
RNA(10?g/mL)for different time intervals(3,9,12,24 hours)and with different concentrations of poly(I:C)RNA (0.5,5,10?g/mL)for12hours,and the expression of ICAM-1,BFGF,PEDG,and VEGF was analyzed by RT-PCR. ICAM-1expression was increased by poly(I:C)RNA after3, 9,12,and24hours of stimulation time;the maximal in-crease was observed after12hours of stimulation.BFGF expression was increased by poly(I:C)RNA after9,12and 24hours,with a maximum after12hours.Poly(I:C)RNA had no effect on the basal expression of PEDG or VEGF. Stimulation with different concentrations of poly(I:C)RNA (0.5,5,10?g/mL)for12hours led to a dose-dependent increase in ICAM-1and BFGF expression,with a maximum under10?g/mL poly(I:C)RNA stimulation.Because we did not observe an increase in PEDG and VEGF on stimulation with poly(I:C)RNA,we did not test expression levels of these genes with different concentrations of poly(I:C)RNA (Fig.
3).
F IGURE4.Effect of transfection with siRNA speci?c for TLR3and RIG-I on poly(I:C)RNA-induced changes in the expression of cytokines, chemokines,adhesion molecules,and factors important for?brosis.RPE cells were transfected with siRNA speci?c for TLR3and RIG-I and for scrambled RNA as a negative control for24hours,as described in Materials and Methods.RPE cells were stimulated with poly(I:C)RNA(10?g/mL) for12hours,and the expression of IL-6(A),TNF-?(B),IL-8(C),MCP-1(D),ICAM-1(E),and BFGF(F)was analyzed by RT-PCR.Poly(I:C)RNA stimulation led to a signi?cant increase in the expression of these genes.Transfection of RPE cells with siRNA speci?c for TLR3reduced poly(I:C) RNA-induced mRNA expression of these genes.siRNA speci?c for RIG-I and negative controls containing unspeci?c RNA had no effect on poly(I:C) IOVS,August2011,Vol.52,No.9Cytokine Pro?le and Alkylphosphocholines6541
Effect of Transfection with siRNA Speci?c for TLR3and RIG-I on Poly(I:C)RNA Induced Changes in the Expression of Cytokines, Chemokines,Adhesion Molecules,and Factors Important for Fibrosis
To identify the viral receptor responsible for poly(I:C)-induced changes in expression of the target genes,RPE was transfected with siRNA speci?c for TLR3,RIG-I,and scrambled RNA as negative control for24hours and was stimulated with poly (I:C)RNA(10?g/mL)for12hours.Expression of IL-6,TNF-?, IL-8,and MCP-1as well as with ICAM-1and BFGF was analyzed by RT-PCR.The signi?cant increase in the expression of all these genes induced by poly(I:C)RNA stimulation was re-duced after the transfection of RPE cells with siRNA speci?c for TLR3.siRNA speci?c for RIG-I and negative controls containing unspeci?c RNA had no effect on poly(I:C)RNA-induced gene expression(Fig.4).
Effect of APC on Poly(I:C)RNA Induced Changes in the Expression of Viral Receptors,Cytokines and Chemokines,Adhesion Molecules,and Factors Important for Fibrosis
RPE cells were pretreated without and with APC in different concentrations(2?M,4?M)for24hours,washed with PBS, and stimulated with different concentrations of poly(I:C)RNA (0.5,5,10?g/mL)alone or in combination with APCs in different concentrations(2?M,4?M)for12hours.The structural formula of APCs is shown in Figure5.Expression of the viral receptors TLR3and RIG-I,the selected cytokines and chemokines IL-6,TNF-?,IL-8,and MCP-1,and of ICAM-1and BFGF was analyzed by RT-PCR.RPE cells showed a basal expression of these genes that was not in?uenced by APCs in the two concentrations tested.Poly(I:C)RNA stimulation led to a dose-dependent increase in the expression of all these genes that was signi?cantly reduced by APCs.The effect of APCs was comparable for the two concentrations tested.APC
F IGURE5.Chemical structure of the APC oleyl-phosphocholine
(C18:1-PC).
F IGURE6.Effect of APC on poly(I:C)RNA-induced changes in the expression of viral receptors,cytokines and chemokines,adhesion molecules, and factors important for?brosis.RPE cells were pretreated without and with APCs in different concentrations(2?M,4?M)for24hours,washed with PBS,and stimulated with different concentrations of poly(I:C)RNA(0.5,5,10?g/mL),alone or in combination with APC(2?M,4?M)for 12hours.Poly(I:C)RNA stimulation led to a dose-dependent increase in the expression of TLR3(A)and RIG-I(B),IL-6(C),TNF-?(D),IL-8(E), MCP-1(F),ICAM-1(G),and BFGF(H).RNA expression was analyzed by RT-PCR.RPE cells showed a basal expression of these genes that was not in?uenced by APC.APCs signi?cantly reduced poly(I:C)RNA-induced increase in expression of the genes mentioned.APCs had no toxic effect 6542Wo¨rnle et al.IOVS,August2011,Vol.52,No.9
had no toxic effect on cell viability tested by a cell death assay, as described in Materials and Methods(Fig.6).
D ISCUSSION
Based on the emerging consensus of local in?ammation con-ferring a substantial risk for the development of AMD,we investigated TLR3as a potential target in this degenerative disease process.Because genotype analyses point to a particu-lar relevance of components of innate immunity including TLR3,we aimed at de?ning TLR3-dependent mediators in RPE considered to be crucial modulators of retinal immune pro-cesses.
By showing an increase in TLR3expression levels on stim-ulation with proin?ammatory cytokines and dose-and time-dependent upregulation of TLR3by the ligand poly(I:C)RNA, we substantiated for the?rst time the functionality of this viral receptor on human RPE cells.Corresponding results are found for the viral receptor RIG-I.Mediators,adhesion molecules,and growth factors known to be TLR3dependent and relevant in in?ammation and?brosis were analyzed.The cytokines IL-6, IL-8,and TNF-?,the chemokine MCP-1,the adhesion molecule ICAM-1,and the growth factor BFGF were shown to exhibit time-and dose-dependent responses to the activation of viral receptors with poly(I:C).Expression levels of PEDF and VEGF were unaffected.Observation of an early induction of proin-?ammatory mediators peaking at12hours corresponded with the results of in vivo data from the TLR3knockout mouse with increased apoptosis and loss of RPE cells as early as48hours after the injection of poly(I:C)in the vitreous.8Knockdown experiments with siRNA speci?c for the viral receptors have provided evidence for these effects being mediated predomi-nantly by TLR3.
Dysregulation of the complement system is considered to be pivotal in the pathogenesis of AMD as the best-characterized clinical example of a progressively degenerative disorder.Fac-tors other than drusen are found to contain components of the complement system such as CFH(complement factor H), which binds to polyanionic structures and inactivates comple-ment C3b,thereby controlling local in?ammatory processes. This is estimated to be of general relevance for local in?amma-tion because both IL-6and TNF-?have been shown to reduce CFH expression in RPE cells.11Furthermore,local accumula-tion of protein degradation products,such as A?and?bronec-tin fragments,are both known to induce IL-8.In RPE cells,IL-6 and MCP-1can perpetuate in?ammation in advanced degener-ative disease.13,16It is thus reasonable to assume that the proin?ammatory cytokines IL-6,IL-8,and TNF-?and the chemokine MCP-1play a role in the development and progres-sion of chronic in?ammation.This might be a simple ampli?-cation of local in?ammatory responses or their interference with complement regulation.The adjuvant effect of BFGF in local glial proliferation and matrix production leading to focal subretinal?brosis is evident.Given that the regulation of all these mediators is dependent on and thereby converges to TLR3in RPE cells,we infer it to play a key role in pathogenesis of local in?ammatory processes,ultimately leading to retinal degeneration.We can only speculate about the relative role of nuclear acid fragments originating from cell debris and viral RNA originating from RNA viruses or generated in the course of DNA virus replication25as a trigger for the imbalance of the local immune system favoring in?ammation by the activation of TLR3.
APCs may be of therapeutic interest for AMD because they broadly inhibit TLR3-mediated upregulation of proin?amma-considered risk factors for AMD development.Additional stud-ies are warranted to further de?ne the mode of action possibly involving lipid raft organization and receptor cycling between intracellular compartments and the cell membrane.In addi-tion,interference of APCs with the complex structure of TLR3,26necessitating a correct positioning of the N-and C-ter-minal ends,is conceivable.
Acknowledgments
The authors thank Katja Obholzer for expert technical assistance.
References
1.Alexopoulou L,Holt AC,Medzhitov R,Flavell RA.Recognition of
double-stranded RNA and activation of NF-?B by toll-like receptor
3.Nature.2001;413:732–738.
2.Kumar MV,Nagineni CN,Chin MS,Hooks JJ,Detrick B.Innate
immunity in the retina:Toll-like receptor(TLR)signaling in human retinal pigment epithelial cells.J Neuroimmunol.2004;153:7–15.
3.Zhang X,Kimura Y,Fang C,et al.Regulation of Toll-like receptor-
mediated in?ammatory response by complement in vivo.Blood.
2007;110:228–236(erratum:Blood.2007;110:3841).
4.Holz F,Wolfensberger T,Piguet B,et al.Bilateral macular drusen in
age-related macular degeneration:prognosis and risk factors.Oph-thalmology.1994;101:1522–1528.
5.Bird A,Bressler N,Bressler S,et al.An international classi?cation
and grading system for age-related maculopathy and age-related macular degeneration:the International ARM Epidemiology Study Group.Surv Ophthalmol.1995;39:367–374.
6.Funk M,Karl D,Georgopoulos M,et al.Neovascular age-related
macular degeneration:intraocular cytokines and growth factors and the in?uence of therapy with ranibizumab.Ophthalmology.
2009;116:2393–2399.
7.Clark SJ,Bishop PN,Day https://www.doczj.com/doc/bb15611511.html,plement factor H and age-related
macular degeneration:the role of glycosaminoglycan recognition in disease pathology.Biochem Soc Trans.2010;38:1342–1348. 8.Yang Z,Stratton C,Francis PJ,et al.Toll-like receptor3and
geographic atrophy in age-related macular degeneration.N Engl J Med.2008;259:1456–1463.
9.Fritsche LG,Lauer N,Hartmann A,et al.An imbalance of human
complement regulatory proteins CFHR1,CFHR3and factor H in-?uences risk for age-related macular degeneration(AMD).Hum Mol Genet.2010;19:4694–4704.
10.Vitour D,Meurs EF.Regulation of interferon production by RIG-I
and LGP2:a lesson in self-control.Sci STKE.2007;384:20.
11.Chen M,Forrester JV,Xu H.Synthesis of complement factor H by
retinal pigment epithelial cells is down-regulated by oxidized pho-toreceptor outer segments.Exp Eye Res.2007;84:635–645. 12.Seddon JM,George S,Rosner B,Rifai N.Progression of age-related
macular degeneration:prospective assessment of C-reactive pro-tein,interleukin-6and other cardiovascular biomarkers.Arch Oph-thalmol.2005;123:774–782.
13.Austin BA,Liu B,Li Z,Nussenblatt RB.Biologically active?bronec-
tin fragments stimulate release of MCP-1and catabolic cytokines from murine retinal pigment epithelium.Invest Ophthalmol Vis Sci.2009;50:2896–2902.
14.Jonas JB,Tao Y,Neumaier M,Findeisen P.Monocyte chemoattrac-
tant protein1,intercellular adhesion molecule1,and vascular cell adhesion molecule1in exudative age-related macular degenera-tion.Arch Ophthalmol.2010;128:1281–1286.
https://www.doczj.com/doc/bb15611511.html,erdhan SV,Ennis S,Hannan SR,et al.Interleukin-8promoter
polymorphism-251A/T is a risk factor for age-related macular degeneration.Br J Ophthalmol.2008;92:537–540.
16.Kurji KH,Ciu JZ,LinT,et al.Microarray analysis identi?es changes
in in?ammatory gene expression in response to amyloid-beta stim-ulation of cultured human retinal pigment epithelial cells.Invest Ophthalmol Vis Sci.2010;51:1151–1163.
17.Eibl KH,Banas B,Schoenfeld CL,et al.Alkylphosphocholines
IOVS,August2011,Vol.52,No.9Cytokine Pro?le and Alkylphosphocholines6543
18.Eibl KH,Banas B,Kook D,et al.Alkylphosphocholines:a new
therapeutic option in glaucoma?ltration surgery.Invest Ophthal-mol Vis Sci.2004;45:2619–2624.
19.Eibl KH,Kook D,Priglinger S,et al.Inhibition of human retinal pigment
epithelial cell attachment,spreading,and migration by alkylphosphocho-lines.Invest Ophthalmol Vis Sci.2006;47:364–370.
20.Eibl KH,Lewis GP,Betts K,et al.The effect of alkylphospho-
cholines in intraretinal proliferation initiated by experimental retinal detachment.Invest Ophthalmol Vis Sci.2007;48:1305–1311.
21.Leonard R,Hardy J,van Tienhoven G,et al.Randomized,double-
blind,placebo-controlled,multicenter trial of6%miltefosine solu-tion,a topical chemotherapy in cutaneous metastases from breast cancer.J Clin Oncol.2001;21:4150–4159.22.Sundar S,Jha TK,Thakur CP,et al.Oral miltefoesine for Indian
visceral leishmaniasis.N Engl J Med.2002;347:1739–1746.
23.Wo¨rnle M,Schmid H,Banas B,et al.Novel role of toll-like receptor
3in hepatitis C-associated glomerulonephritis.Am J Pathol.2006;
168:370–385.
24.Matsukura S,Kokubu F,Kurikawa M,et al.Role of RIG-I,MDA-5,
and PKR on the expression of in?ammatory chemokines induced by synthetic dsRNA in airway epithelial cells.Int Arch Allergy Immunol2007;143(suppl1):80–83.
25.Marshall-Clarke S,Downes JE,Haga IR,et al.Polyinosinic acid is a
ligand for Toll-like receptor3.J Biol Chem.2007;282:24759–24766.
26.Botos I,Liu L,Wang Y,Segal DM,Davies DR.The toll-like receptor
3:dsRNA signaling complex.Biochim Biophys Acta.2009;1789: 667–674.
6544Wo¨rnle et al.IOVS,August2011,Vol.52,No.9