当前位置：文档之家› Murine endothelial cell lines as models of tumorendothelial cells

Murine endothelial cell lines as models of tumorendothelial cells

Murine Endothelial Cell Lines as Models of Tumor Endothelial Cells

Jennifer Walter-Yohrling,Sharon Morgenbesser, Cecile Rouleau,Rebecca Bagley,

Michelle Callahan,William Weber,and

Beverly A.Teicher

Genzyme Corporation,Framingham,Massachusetts ABSTRACT

Identification of appropriate models for in vivo and in vitro preclinical testing of inhibitors of tumor angiogenesis and progression is vital to the successful development of anticancer therapeutics.Although the focus is on human molecular targets,most preclinical in vivo efficacy testing occurs in mice.The goal of the current studies was to identify a murine endothelial cell line to model tumor endo-thelium for studying the antiangiogenic activity of therapeu-tic compounds in vitro.In situ hybridization was performed on three s.c.grown syngeneic murine tumors(B16mela-noma,Lewis lung carcinoma,and CT26colon carcinoma)to assess expression of murine homologs of human tumor en-dothelial cell markers in the vasculature of these tumor models.Seven murine endothelial cell lines were character-ized for expression of the murine homologs of recognized endothelial cell surface markers as well as for tumor endo-thelial cell surface markers.The seven murine endothelial cell lines had similar generation times and five of the seven lines were able to form tubes on Matrigel.Real-time-PCR and flow cytometry analysis were used to evaluate relative mRNA and protein expression of murine homologs of sev-eral recognized endothelial cell surface markers in the seven cell lines.The expression of the mRNA for the murine homologs of five tumor endothelial cell surface markers was also evaluated.The2H11cell line expressed all five of the tumor endothelial cell surface markers as well as several well-recognized endothelial cells markers.The2H11cell line responds to known and novel antiangiogenic agents by in-hibition of proliferation and tube formation.These cells can be used in in vitro angiogenesis assays for evaluating the potential antiangiogenic properties and interspecies cross-reactivity of novel compounds.INTRODUCTION

The mouse has become the critical host organism for the discovery and development of modern cancer therapeutics. However,it is important that we understand the strengths and limitations of mouse models of malignant disease(1).The most frequently used murine models are transplantable syngeneic or xenograft tumors and transgenic mice that develop autologous tumor nodules during their lifetimes.These models allow the study of biological processes associated with tumor growth, including the tumor-host interactions with murine stromal cells.

The abnormality of tumor vasculature has been studied extensively in mouse models.Modzelewski et al.(2)isolated and characterized fresh tumor-derived endothelial cells from the syngeneic RIF-1fibrosarcoma.The dynamics of blood vessel growth,structure,cellular composition and gene expression have been followed using the murine syngeneic mammary MCaIV adenocarcinoma,the murine syngeneic Lewis lung car-cinoma,and the murine transgenic RIP-Tag2pancreatic islet cell tumor(3–5).The mobilization of bone marrow progenitor cells to circulation,the maturation of these cells into endothelial precursor cells,and the incorporation of the endothelial precur-sor cells from circulation into tumor vasculature has been elu-cidated largely in mice(6–14).These studies used murine syngeneic tumors,human tumor and bone marrow xenografts in immunodeficient mice and genetically engineered mice,and have been used to recapitulate the dynamics of processes ob-served in human patients.

Cancer therapeutics has moved away from general prolif-eration-related targets such as DNA and tubulin toward more nontraditional pathological processes including angiogenesis or immunomodulation,as well as more selective molecular targets. In most cases,efficacy in mouse models remains the critical determinant of whether a potential therapeutic moves into de-velopment in clinical trials.However,it has become evident that the homology between the murine and human proteins of spe-cific molecular targets is,frequently,not sufficient to depend on efficacy of agents selected for the murine target to translate into highly effective therapy in the human clinic.This is most evident in the selection of monoclonal antibodies where it is has become necessary to develop monoclonal antibodies to the murine homologue of the human target(11).Therefore,mouse and human agents need to be developed in parallel,so that the tumor-bearing mouse remains the critical efficacy hurdle.Like-wise,it is important to define cell-based models of murine tumor endothelial cells that can be used to evaluate potential therapeu-tics in cell culture to select those most appropriate for in vivo testing.

The isolation and maintenance of a pure population of primary murine endothelial cells has proven to be difficult and has restricted the use of these cells in angiogenesis assay sys-tems.To overcome these barriers,several groups have generated murine endothelial cell lines from cells isolated from the axil-

Received7/9/03;revised12/1/03;accepted12/05/03.

The costs of publication of this article were defrayed in part by the payment of page charges.This article must therefore be hereby marked advertisement in accordance with18U.S.C.Section1734solely to indicate this fact.

Requests for reprints:Beverly A.Teicher,Genzyme Corporation,1 Mountain Road,Framingham,MA01701,Phone:(508)271-2843, FAX:(508)620-1203,E-mail:Beverly.Teicher@https://www.doczj.com/doc/0e7686393.html,.2179

Vol.10,2179–2189,March15,2004Clinical Cancer Research

lary lymph node(15–17),embryonic yolk saks(6),and aorta, brain,and heart capillaries(18).In selecting the appropriate murine in vitro model of tumor endothelial cells,it is ideal to identify a murine endothelial cell line that maintains the expres-sion of traditional endothelial cell markers as well as markers found to be expressed by human tumor endothelial cells(19, 20).Thus,in the process of targeted antiangiogenic drug dis-covery,having identified cell-based models expressing the hu-man target and cell-based models expressing the murine target allows comparison of the sensitivity of the human and mouse targets to therapeutic candidates and allows an informed deci-sion to be made regarding selection of therapeutic candidates for testing in in vivo models with murine vasculature.

O’Connell et al.(15–17)generated several murine endo-thelial cell lines from endothelial cells isolated from axillary and inguinal lymph nodes of adult C3H/HeJ mice and transformed the cells using SV40.When implanted in mice,these immor-talized endothelial cells produced nodules that displayed the characteristics of Kaposi’s sarcoma,a multifocal malignant neo-plasm consisting of spindle cells and believed to be derived from endothelial cells.The SVEC4–10EE2cell line was de-rived from the parent SVEC4–10cell line by the extraction of tumors generated after the injection of the parent cell line in nude mice.These cells were then sub-cloned using conditioned medium from SVEC4–10EE2to isolate a slower growing mu-rine endothelial cell line designated SVEC4–10EHR1.IP2E4 and3B11cell lines were sub-cloned from ascites fluid generated in mice that received implantation with SVEC4–10EHR1cells. The2H11cell line was sub-cloned from a nodular spindle-like tumor derived from the SVEC4–10EHR1cell line.The2F2B cell line was developed from a lobular cutaneous tumor result-ing from the implantation of SVEC4–10EE2cells.Each of the seven murine endothelial cell lines has distinctive cellular mor-phology as well as different endothelial cell characteristics, including the expression of von Willebrand factor/Factor VIII, the incorporation of acetylated low-density lipoprotein,the up-regulation of class II MHC expression in response to IFN?,and the formation of tubular networks on Matrigel(15–17).

There are several markers that have proven useful for identifying endothelial cells in situ and in vitro,including plate-let endothelial cell adhesion molecule-1/CD31,von Willebrand factor,P1H12,and vascular endothelial growth factor receptor2 (VEGFR2;Refs.21–24).These cell surface proteins have tis-sue-type and vasculature-specific expression patterns.Recently, several novel markers have been identified that are specific for human tumor endothelial cells(TEM;19).The TEM expression pattern for the murine homologue of several of these markers was determined in murine B16melanoma and human HCT116 colon carcinoma xenografts by in situ hybridization(20).These markers provide criteria for identification of appropriate murine endothelial cells for studying tumor endothelial properties.

The goal of these studies was to identify by the behavior, as well as the mRNA and protein expression of normal and tumor endothelial cell markers,the murine endothelial cell line(s)that is the most appropriate model of tumor endothelium for in vitro study of the biology of tumor angiogenesis. MATERIALS AND METHODS

Chemicals.Murine endothelial cell lines,SVEC4–10, SVEC4–10EE2,SVEC4–10EHR1,2F2B,2H11,IP1B,and IP2-E4,were purchased from American Type Culture Collec-tion(Manassas,VA).Human dermal neonatal microvascular endothelial cells(HMVEC)and EGM2-MV were obtained from Cambrex(East Rutherford,NJ).Cell culture media,versene, and fetal bovine serum(FBS)were purchased from Invitrogen Corp.(Carlsbad,CA).Primary antibodies against endothelial cell markers were purchased from PharMingen(San Diego,CA) and Chemicon(Temecula,CA;Table1).Phycoerythrin and fluorescein-conjugated secondary antibodies were obtained from Jackson ImmunoResearch Laboratories(West Grove,PA). PCR primers that recognize the human and mouse gene were purchased from Integrated DNA Technologies(Coralville,IA). Trizol was purchased from Sigma(St.Louis,MO),and the RNA Extraction Kit was obtained from Qiagen(Valencia,CA).The High-Capacity cDNA Archive Kit,Taqman rRNA Control Re-agents,Taqman Universal PCR Master Mix,and Sybr Green PCR Master Mix were purchased from Applied Biosystems (Foster City,CA).Cell Titer Glo was purchased from Promega (Madison,WI).

Cell Culture.The murine endothelial cell lines2F2B, 2H11,3B11,IP2E4,SVEC4–10,SVEC4–10EE2,and SVEC4–10EHR1were maintained in DMEM plus10%fetal bovine serum in a humidified10%CO

environment.HMVECs were maintained in EGM2-MV that includes5%FBS,vascular en-dothelial growth factor(VEGF),basic fibroblast growth factor,

Table1List of endothelial cell markers studied,the antibody used for FACS a analysis,and primer sequences for mRNA expression analysis EC marker Antibody Forward primer Reverse primer CD34/sialoucin Pharmingen cat.553731gaagacccttattacacgga gctgaatggccgtttct

CD36/GPIIIb Chemicon cat.MAB1258N/A N/A

CD105/endoglin Pharmingen cat.550546cagcaagcgggagcccgtggt ggtgctctgggtgctcccgat

ENDRB N/A gcagaggactggccatttgga gcaacagctcgatatctgtcaatact

P1H12/CD146Chemicon cat.MAB16985N/A N/A

Tie1N/A tggagatagtgagccttgga cagtttcgaggctgctccatgcg

Tie2Chemicon cat.MAB1148gagattgttagcttaggaggcac gtctcattagatcatacacctcatcat

VCAM1/CD106Pharmingen cat.553330gacctgttccagcgagggtcta cttccatcctcatagcaattaaggtgg

VEGFR1N/A ctgggagcctgcacgaagcaa gtcacgtttgctcttgaggtagt

VEGFR2Pharmingen cat.555308gcagacagaaatacgtttgagttgg agtgattgccccatgtgga

FACS,fluorescence-activated cell sorter;EC,endothelial cell;ENDRB,endothelin-B receptor;VCAM,vascular cellular adhesion molecule;

VEGFR,vascular endothelial growth factor receptor;cat.,catalogue number.

2180Mouse Model of In Vitro Angiogenesis

epidermal growth factor,and insulin-like growth factor,in a

humidified5%CO

atmosphere.

Generation Time and Proliferation.To determine cel-lular growth rates,cells from each of the seven murine endo-thelial cell lines(2?103)were placed in each well of a96-well plate in DMEM supplemented with0,2,5or10%FBS.The cells were collected after24,48,72,and96h using Cell Titer Glo and extrapolating cell number from a standard curve for each cell line.Generation time was calculated by applying an exponential curve fit to the cell number values and calculating the time required for the cell number to double.For proliferation experiments,cells were exposed to each agent for48h,and cell numbers were determined as described above.

In Vitro Tube Formation.Matrigel(BD Biosciences) was added to the wells of a48-well plate in a volume of120?l and allowed to solidify at37°C for30min.After the Matrigel solidified,cells from each of the seven murine endothelial cell lines(2?104cells)were added in200?l of DMEM supple-mented with10%FBS.The cells were incubated at37°C with

humidified95%air/5%CO

for5h in the presence or absence of a potential inhibitor.

Quantitative PCR.A confluent T75flask of cells was harvested and lysed using Trizol.RNA was isolated by phenol chloroform extraction followed by column isolation using the Qiagen RNA Extraction Kit.cDNA was generated using the High Capacity cDNA Archive Kit.Real-time-PCR for normal endothelial cell markers was performed with Sybr Green PCR Master Mix using the primers listed in Table1on an ABI Prism 7700Sequence Detection System(Applied Biosystems).Rela-tive mRNA expression of normal endothelial cell markers was determined by the?-delta Ct method where the cycle threshold (Ct)of the sample is subtracted by the Ct of18S and compared with the reference expression by HMVEC.Expression of the tumor endothelial cell markers was determined using FAM-labeled probes and Taqman Universal PCR Master Mix,expres-sion was normalized to18S and compared with the reference expression by2H11cells.

Flow Cytometry Analysis.Cells were suspended by ex-posure to versene and0.005%trypsin and then washed with PBS containing5%FBS.Cells from each of the seven murine endothelial lines(2?105)were incubated with1?g of primary antibody diluted in PBS containing5%FBS in100?l total volume for1h.The cells were washed twice in PBS containing 5%FBS and incubated with a1:50dilution of the appropriate fluorescently conjugated secondary antibody for1h.Samples were analyzed using an FACSCaliber flow cytometer(Becton Dickinson,Franklin Lakes,NJ).The results were compared with appropriate isotype controls.Positive expression was deter-mined by dividing the number of cells stained with the antibody by the total number of cells assayed multiplied by100(percent-positive cells).Each determination was based on10,000events.

In Situ Hybridization.Briefly,cDNA fragments were generated by PCR amplification of fragments ranging from200 to650bp,using primers with T7promoters incorporated into the antisense primers(19,20).Digoxigenin riboprobes were generated by in vitro transcription in the presence of digoxige-nin,according to manufacturer’s instructions(Roche,Indianap-olis,IN).Murine syngeneic tumors,B16melanoma,Lewis lung carcinoma,and CT-26colon carcinoma grown s.c.were har-vested and prepared as formalin-fixed,paraffin-embedded3–5

?m sections on slides.All treatments were carried out at room temperature,unless otherwise stated.Sections were deparaf-finized in xylene,washed in100%ethanol,then hydrated in85, 75,and50%ethanol in distilled water.After incubation in diethyl pyrocarbonate-treated water(Quality Biological,Inc., Gaitherburg,MD),sections were permeabilized by treatment with pepsin in0.2N hydrochloric acid,washed briefly in PBS, then fixed in4%paraformaldehyde.Sections were acetylated in acetic anhydride/0.1M triethanolamine(pH8.0),equilibrated for

10min in5?SSC[3M sodium chloride,0.3M sodium citrate (pH7.0);Invitrogen],and prehybridized for1to2h at55°C in mRNA hybridization buffer(DAKO,Carpinteria,CA).Sections were hybridized with digoxigenin riboprobes(100–200ng/ml)

in mRNA hybridization buffer(DAKO)overnight at55°C. After removing unbound riboprobes by washing,sections were incubated with RNase(Ambion,Austin,TX)to remove any nonspecific-bound riboprobe.Sections were treated with perox-idase block(DAKO)to eliminate any endogenous peroxidase, then blocked with a1%blocking reagent(DIG nucleic acid detection kit;Roche),containing rabbit immunoglobulin frac-tion(DAKO),in Tris buffered saline.Rabbit antidigoxigenin-horseradish peroxidase(DAKO)was used to detect the ribo-probes and served to catalyze the deposition of biotinylated tyramide(Gen-Point,DAKO)according to manufacturer’s in-structions.Additional amplification was accomplished through additional rounds of strept-av-horseradish peroxidase(Gen-Point,DAKO)and biotinylated tyramide.Final detection was accomplished through rabbit antibiotin conjugated to alkaline phosphatase(DAKO).Alkaline phosphatase was detected with Fast Red(DAKO)for10–60min at RT,then counterstained in hematoxylin.The nuclei were blued with ammonium hydroxide

for30s,then mounted with crystal-mount(BioMeda,Foster City,CA).For the negative control,sense riboprobes were used

to detect any nonspecific sequences.Additionally,a slide that was exposed to RNase to destroy the mRNA was hybridized with the antisense riboprobe to detect any nonspecific hybrid-ization.

RESULTS

In situ hybridization was performed on tissue sections of three murine syngeneic tumors,B16melanoma,Lewis lung carcinoma,and CT-26colon carcinoma grown s.c.in the ap-propriate hosts to determine the mRNA expression of the mu-rine homologs of the known endothelial cell marker,VEGFR2, and the murine homologs of several tumor endothelial cell markers in the intratumoral vessels.The tumor endothelial cells were found to express VEGFR2as well as murine(m)TEM1, mTEM3,mTEM5,and mTEM8in all three in vivo mouse models of tumor vasculature as was previously shown by Car-son-Walter et al.(Ref.20;Fig.1).Like Carson-Walter et al.,we found that the B16melanoma was negative for mTEM7;how-ever,this marker was expressed by the vasculature of both the Lewis lung carcinoma and the CT26colon carcinoma.The confirmation that the murine homologs of several markers iden-tified in endothelial cells isolated from human tumors are ex-pressed in these transplantable murine syngeneic tumor models validates their use in the study of tumor endothelial biology and

2181

Clinical Cancer Research

Fig.1In situ hybridization of the following s.c.grown syngeneic mouse tumors:B16melanoma,Lewis lung carcinoma,and CT-26colon carcinoma.Tissue sections (5?m)of each tumor were stained with hematoxylin and exposed to riboprobes for mouse vascular endothelial growth factor receptor 2(VEGFR2),murine tumor endothelial cell (mTEM)1,mTEM 7(A ),and mTEM 8,mTEM 9,and mTEM 3(B )and visualized by amplification with fast red chromagen.Images were taken at ?20magnification.LLC ,Lewis lung carcinoma.

2182Mouse Model of In Vitro Angiogenesis

provides guidance for selection of murine endothelial cell lines that would be appropriate models for tumor angiogenesis in cell culture.

The generation times for each of the seven murine endo-thelial cell lines 2H11,2F2B,3B11,IP2E4,SVEC4–10,SVEC4–10EE2,and SVEC4–10EHR1were determined (Fig.2).The effect of serum on the proliferation of each cell line was assessed at concentrations of 2,5,and 10%FBS.Cell number was determined at 24,48,72,and 96h using standard curves derived from a metabolic luminescent end point.The effect of serum concentration on the cellular proliferation was small except with the slower growing SVEC4–10EHR1cells with generation time increased 1.8-fold when the cells were grown at the lowest serum concentration.In general the primary deriva-tive cell lines,SVEC4–10EE2and SVEC4–10EHR1,from the parental SVEC4–10line were slower growing than the second-ary derivative lines,2F2B,2H11,3B11,and IP2E4.The cell line with the shortest doubling time was the 2H11cells with a generation time of 18.7h at a serum concentration of 10%FBS and a generation time of 23.8h at a serum concentration of 2%FBS.

The assembly of cells into tubes/networks on a layer of extracellular matrix components is characteristic of endothelial cells in culture.The capability of each of the seven murine endothelial cell lines to assemble into tubes/networks was as-sessed in a tube formation assay on a layer of Matrigel over a 5h period (Fig.3).The parental cell line SVEC4–10was capable of tube formation.Neither one of the initial derivative lines,SVEC4–10EE2or SVEC4–10EHR1,were able to form tubes on Matrigel.The second derivative line,2F2B,that was derived from the SVEC4–10EE2was able to form tubes on Matrigel,and each of the lines derived from the SVEC4–10EHR1cells were also active in the tube formation assay.The mRNA expression of the murine homologs of recog-nized cell surface endothelial cell markers in each of the seven murine endothelial cell lines was compared with the expression of the same marker in primary HMVEC using primers that recognized both murine and human mRNAs (Fig.4).The mRNA expression of each marker in the murine endothelial cell lines is represented as the expression relative to HMVECs.The expression of VEGFR2,VEGFR1,and Tie1by the murine endothelial cells was similar to the expression in HMVEC.The mRNA for endgolin/CD105and endothelin receptor B was found at much lower levels in the murine cell lines than in HMVEC,and the mRNA for sialomucin/CD34was found at much higher levels in the murine endothelial cells than in HMVEC.The SVEC4–10parent cell line expressed VEGFR1,VEGFR2,endothelin receptor B,and Tie1but not endoglin/CD105or sialomucin/CD34.The first derivative cell lines,SVEC4–10EE2and SVEC4–10EHR1,had similar mRNA ex-pression patterns to the parental cell line except that expression of VEGFR1is markedly decreased,and expression of endoglin/CD105is increased in the SVEC4–10EE2cells.The 2F2B cell line that was derived from the SVEC4–10EE2cells also has decreased expression of VEGFR1mRNA relative to the other murine endothelial cell lines.Only the 2H11cell line and the two lines derived from ascites,3B11and IP2E4,expressed all six of the cell surface endothelial cell markers.

Because the goal is to identify a murine endothelial cell line that could be useful as a model for tumor endothelial cells,the mRNA expression of cell surface markers predicted to be selective for tumor endothelial cells was evaluated (Fig.5).The expression of the mouse homologs of five tumor endothelial markers identified in endothelial cells isolated from human colon carcinoma was determined in six murine endothelial cell lines,and values are relative to the expression in 2H11

cells.

Fig.2Generation times for each of the seven murine endo-thelial cell lines at three concen-trations of fetal bovine serum (FBS;2,5,and 10%)determined over a 96h period.Generation times (h)were calculated by ap-plying an exponential curve fit to the growth curve data and extrap-olating cell number doubling time in the presence of each se-rum concentration.The data are the means and SD of three inde-pendent experiments.

2183

Clinical Cancer Research

Overall,the 2H11cell line was the highest expressor of these markers.The two lines derived from ascites,3B11and IP2E4,were also good expressors of all of the markers.The related lines SVEC4–10EE2and 2F2B had variable expression of the markers and were particularly low expressors of mTEM7and mTEM1.On the basis of this analysis,the murine 2H11endo-thelial cell line appeared to be the most promising model for tumor endothelial cells.

Antibodies specific for the murine homologs for several recognized endothelial cell surface proteins are available.The cell surface expression of five endothelial cell markers was assessed for the seven murine endothelial cell lines and,using human specific antibodies,for HMVEC,by flow cytometry (Table 2).As might be expected from the mRNA expression results,none of the seven murine endothelial cell lines expressed endoglin/CD105,although HMVEC had strong expression of the endoglin protein.Three of the murine endothelial cell lines,2H11,3B11and IP2E4,expressed sialomucin/CD34protein as was reflected by the mRNA expression in these same three cell lines.All of the murine endothelial cells had some expression of gPIIIB/CD36.Only the 2H11cell line expressed P1H12/CD146.Although all of the murine endothelial cell lines ex-pressed vascular cellular adhesion molecule 1(VCAM1)/CD106,the expression level for VCAM1by the 2H11and SVEC4–10EHR1cell lines was most similar to that of the HMVEC.

The 2H11mouse endothelial cell line has been tested in

standard endothelial cell functional assays.In a proliferation assay,2H11cells were exposed to a control anti-2,4-dinitrophe-nol antibody or to an anti-TEM antibody at a concentration of 100?g/ml or were exposed to SU5416(10or 50?M )for 48h (Fig.6).Although neither antibody altered the proliferation of the 2H11cells,SU5416inhibited proliferation in a concentra-tion-dependent manner.The 2H11cells form tubes in 4to 5h on a Matrigel surface.Exposure of the cells to SU5416(50?M )during that time was able to disrupt tube formation (Fig.6).Exposure of the cells to anti-TEM antibody also disrupted tube formation although exposure to the control anti-2,4-dinitrophe-nol antibody did not.

DISCUSSION

The identification of a murine endothelial cell line that has tumor endothelial marker expression is important for the appro-priate analysis of tumor angiogenesis and potential antiangio-genic anticancer strategies in vitro .These experiments have identified the 2H11immortalized murine endothelial cells to be a relevant murine model for tumor endothelial cells because 2H11cells express many of the murine homologs of standard endothelial cell markers,including sialomucin/CD34,GPIIIB/CD36,endogolin/CD105,P1H12/CD146,and VCAM1/CD106,as well as several murine homologs of tumor endothelial mark-ers.Like normal endothelial cells,the 2H11cells will form a cellular network when grown on extracellular

matrices.

Fig.3Inverted,phase microscope images of each of the seven murine endothelial cell lines (2?104cells/well)in a tube formation assay on a thick layer of Matrigel for 5h at 37°C.

2184Mouse Model of In Vitro Angiogenesis

The variety of endothelial cell markers that were studied represent many aspects of endothelial cell function,but not all are specific for endothelial cells.Platelet endothelial cell adhe-sion molecule-1/CD31is also expressed by platelets,mono-cytes,neutrophils and selected T-cell subsets.The platelet en-dothelial cell adhesion molecule-1/CD31protein plays a major role in the cell-cell interactions of endothelial cells and is widely accepted as a pan-endothelial marker of all types of endothelial cells (21,22).Sialomucin/CD34also participates in cell-cell interactions by playing a role in adherens junction formation and is primarily expressed by the tumor neovasculature (23).GPIIIB/CD36expression has been identified on human dermal microvascular endothelial cells as well as other nonendothelial cell types,including platelets and monocytes (24).The GPIIIB glycoprotein binds to extracellular matrix proteins including thrombospondin and collagen (25,26)and is believed to play a role in the vascular complications associated with malaria (27).Endoglin/CD105is related to the transforming growth factor-?type III receptor and has been found to be expressed by endo-thelial cells (28).It has been shown that endoglin/CD105plays a role in normal vascular architecture and has been found to be elevated in tumor endothelial cells in some systems (29,30).Using antibodies selective for endothelin receptor B,Shetty et al.(31)found this receptor on the surface of vascular endothelial and smooth muscle cells and defined its role in mediating vasoregulatory activity.P1H12/CD146is involved in calcium-independent homotypic microvascular endothelial cell adhesion and has become a widely used marker for microvascular endo-thelial cells (19,32,33).Tie1and Tie2are tyrosine kinase receptors for angiopoietin 1and 2believed to be specifically expressed on endothelial cells.The angiopoietin/Tie1and Tie2pathways are involved in embryonic and tumor angiogenesis mediating endothelial cell motility and recruitment of peri-endothelial cells (34–37).The adhesion molecule,VCAM-1/CD106,has been used as a marker for endothelial cells.In some systems,levels of VCAM-1correlate with vascular injury and tumor progression (33,38–40).The VEGF pathway including VEGF and the receptors,VEGFR1(flt-1)and VEGFR2(kinase insert domain-containing receptor/flk-1),is critical in embry-onic,normal,and tumor angiogenesis (41).The VEGF receptors are expressed on varied cells,including monocytes (VEGFR1),neuronal precursor cells (VEGFR1and VEGFR2),and podo-cytes (VEGFR2),but are most highly expressed on resting and active endothelial cells (42–44).

St.Croix et al.(19)identified genes that were up-regulated in endothelial cells isolated from a human colon carcinoma

Fig.4Relative mRNA expression of the murine homologs of recognized endothelial cell surface markers determined by real-time-PCR.The results were normalized to 18S mRNA expression and compared with the expression of the same human endothelial cell surface markers by human microvascular endothelial cell(s)(HMVEC).The data are the means for two independent experiments.VEGFR ,vascular endothelial growth factor receptor;ENDRB ,endothelin-B receptor.

2185

Clinical Cancer Research

compared with endothelial cells isolated from normal colon mucosa from the same patient.The genes expressed by the colon tumor endothelial cells differed significantly from the genes expressed by HMVEC and human umbilical vein endothelial cell,the cells traditionally used when studying angiogenesis in vitro .Therefore,the identification of cells or cell lines with a gene expression profile more relevant to malignant disease is critical.Carson-Walter et al.(20)identified several human tu-mor endothelial markers predicted to be associated with the cell surface and verified the differential expression pattern of the homologs,mTEM1,mTEM5,and mTEM8in murine tumor endothelial cells.The immortalized murine endothelial cell line,

Table 2Flow cytometry detection of murine homologs recognized endothelial cell surface proteins.

Murine endothelial cell lines were assessed for the expression of endothelial cell marker proteins using antibodies directed toward the mouse proteins.The same endothelial cell markers were assessed on HMVEC a using antibodies directed toward the human protein.The data are presented as the percentage of the cell population expressing the protein.

Cell type Endothelial cell surface marker

Sialomucin CD34

GPIIIB CD36Endoglin CD105P1H12CD146VCAM1CD1062H113131518202F2B 2723923B1161242786IP2E4

12284786SVEC4–104222597SVEC4-10EE22192599SVEC4-10EHR12242936HMVEC

HMVEC,human microvascular endothelial cell;VCAM,vascular cellular adhesion molecule.

Fig.5Relative mRNA expression of the murine homologs of tumor endothelial cell surface markers determined by real-time-PCR.The results were normalized to 18S mRNA expression and are expressed relative to the expression level of each marker in 2H11cells.The data are the means for two independent experiments.mTEM ,murine tumor endothelial cell.

2186Mouse Model of In Vitro Angiogenesis

2H11,expresses relatively high levels of mTEM1,mTEM5,mTEM7,and mTEM8,suggesting that these cells may be a useful model of tumor endothelial cells for cell-based assays.

The mouse remains the model species of choice in cancer experimental therapeutics.It is critical to the selection of po-tential therapeutics to be aware of the similarities and differ-ences between the human and murine molecular targets.Be-cause of the inter-species differences in specific molecular targets,it is often necessary to development potential therapeu-tic agents directed toward the murine protein.Whether synge-neic murine tumors or human tumor xenograft models are used,the stromal compartment of the tumors is murine.Several strat-egies have been used to transplant functional human endothelial cells into immunodificient SCID mice such as s.c.implantation of a Matrigel matrix,collagen/fibronectin matrices,or polylactic acid sponges containing genetically altered human umbilical vein endothelial cell or HMVEC (45–49).Alternatively,the SCID mouse has been successfully engrafted with human stem cells (50).Raychaudhuri et al.(51)developed a model that involves the transplantation of human psoriasis plaques into SCID mice that maintain the hyperproliferative characteristics of the psoriasis as well as a functional human vasculature.These methods allow human angiogenesis in a murine host but are not models of angiogenesis associated with malignant disease.

Animal models including genetically engineered mice and xeno-transplanted mice are being developed to facilitate the assessment of therapies directed toward human angiogenesis targets in the mouse.However,the mouse remains important in early preclinical development of potential antiangiogenic ther-apies.Cell-based models,including endothelial cell prolifera-tion,migration,and tube formation,are well-established as the primary screen for potential antiangiogenic activity.Performing these assays in both human and murine endothelial cells that have characteristics of human tumor endothelial cells from patients is the ideal.The immortalized murine 2H11endothelial cell line appears to be an appropriate murine endothelial cell model of tumor angiogenesis.Continuing use of these murine cells in cell-based angiogenesis assays will be needed to estab-lish their usefulness in understanding endothelial cell biology and drug

discovery.

Fig.6A,number of 2H11cells after 48-h exposure to anti-2,4-dinitrophenol (anti-DNP)control antibody (100?g/ml),anti-tumor en-dothelial cell (anti-TEM)antibody (100?g/ml),or SU5416(10or 50?M ).B,inverted,phase microscope images of each of 2H11murine endothelial cells (2?104cells/well)in a tube formation assay on a thick layer of Matrigel for 4h at 37°C alone (PBS)or along with exposure to anti-DNP control antibody (100?g/ml),anti-TEM antibody (100?g/ml),or SU5416(50?M ).

2187

Clinical Cancer Research

REFERENCES

1.Teicher BA,editor.Tumor Models in Cancer Res.New Jersey:The Humana Press,Inc.,2001.

2.Modzelewski RA,Davies P,Watkins SC,Auerbach R,Chang M-J, Johnson CS.Isolation and identification of fresh tumor-derived endo-thelial cells from a murine RIF-1fibrosarcoma.Cancer Res1994;54: 336–9.

3.Morikawa S,Baluk P,Kaidoh T,Haskell A,Jain RK,McDonald DM.Abnormalities in pericytes on blood vessels and endothelial sprouts in tumors.Am J Pathol2002;160:985–1000.

4.Thurston G,Suri C,Smith K,et al.Leakage-resistant blood vessels in mice transgenically overexpressing angiopoietin-1.Science(Wash D

C)1999;286:2511–4.

5.Brown EB,Campbell RB,Tsuzuki Y,et al.In vivo measurement of gene expression,angiogenesis and physiological function in tumors using multiphoton laser scanning microscopy.Nat Med2001;7:864–8.

6.Lu L,Wang S,Auerbach R.In vitro and in vivo differentiation into

B Cells,T cells and myeloid cells of primitive yolk sac hematopoietic precursor cells expanded?100-fold by coculture with a clonal yolk sac endothelial cell line.Proc Natl Acad Sci USA1996;93:14782–7.

7.Capillo M,Mancuso P,Gobbi A,et al.Continuous infusion of endostatin inhibits differentiation,mobilization,and clonogenic poten-tial of endothelial cell progenitors.Clin Cancer Res2003;9:377–82.

8.Shirakawa K,Furuhata S,Watanabe I,et al.Induction of vasculo-genesis in breast cancer models.Br J Cancer2002;87:1454–61.

9.Luttun A,Carmeliet G,Carmeliet P.Vascular progenitors:from biology to treatment.Trends Cardiovasc.Med2002;12:88–96.

10.Shirakawa K,Shibuya M,Heike Y,et al.Tumor-infiltrating endo-thelial cells and endothelial precursor cells in inflammatory breast cancer.Int J Cancer2002;99:344–51.

11.Lyden D,Hattori K,Dias S,et al.Impaired recruitment of bone-marrow-derived endothelial and hematopoietic precursor cells blocks tumor angiogenesis and growth.Nat Med2001;7:1194–201.

12.Heissig B,Hattori K,Dias S,et al.Recruitment of stem and progenitor cells from the bone marrow niche requires MMP-9mediated release of kit-ligand.Cell2002;109:625–37.

13.Asahara T,Masuda H,Takahashi T,et al.Bone marrow origin of endothelial progenitor cells responsible for postnatal vasculogenesis in physiological and pathological neovascularization.Circ Res1999a;85: 221–8.

14.Asahara T,Takahashi T,Masuda H,et al.VEGF contributes to postnatal neovascularization by mobilizing bone marrow-derived endo-thelial progenitor cells.EMBO J1999b;18:3964–72.

15.O’Connell KA,Edidin M.A mouse lymphoid endothelial cell line immortalized by simian virus40binds lymphocytes and retains func-tional characteristics of normal endothelial cells.J Immunol1990;144: 521–5.

16.O’Connell K,Landman G,Farmer E,Edidin M.Endothelial cells transformed by SV40T antigen cause Kaposi’s sarcomalike tumors in nude mice.Am J Pathol1991;139:743–9.

17.O’Connell KA,Rudmann AA.Cloned spindle and epitheliodid cells from murine Kaposi’s sarcoma-like tumors are of endothelial origin. J Investig Dermatol1993;100:742–5.

18.Bastaki M,Nelli EE,Dell’Era P,et al.Basic fibroblast growth factor-induced angiogenic phenotype in mouse endothelium:a study of aortic and microvascular endothelial cell lines.Arterioscler Thromb Vasc Biol1997;17:454–64.

19.St.Croix B,Rago C,Velculescu V,et al.Genes expressed in human tumor endothelium.Science(Lond)2000;289:1197–202.

20.Carson-Walter EB,Watkins DN,Nanda A,Vogelstein B,Kinzler KW,St.Croix B.Cell surface tumor endothelial markers are conserved in mice and humans Cancer Res2001;61:6649–55.

21.Scholz D,Schaper J.Platelet/endothelial cell adhesion molecule-1 (PECAM-1)is localized over the entire plasma membrane of endothelial cells.Cell Tissue Res1997;290:623–31.22.Wong D,Dorovini-Zis K.Platelet/endothelial cell adhesion mole-cule-1(PECAM-1)expression by human brain microvessel endothelial cells in primary culture.Brain Res1996;731:217–20.

23.Krause DS,Fackler MJ,Civin CI,May WS.CD34:structure, biology,and clinical utility.Blood1996;87:1–12.

24.Swerlick RA,Lee KH,Wick TM,Lawley TJ.Human dermal microvascular endothelial but not human umbilical vein endothelial cells express CD36in vivo and in vitro.J Immunol1992;148:78–83.

25.Asch AS,Barnwell JW,Silverstein RL,Nachman RL.Isolation of thrombospondin membrane receptor.J Clin Investig1987;79:1054–61.

26.Tandon NN,Kralisz U,Jamieson GA.Identification of glycoprotein IV(CD36)as a primary receptor for platelet-collagen adhesion.J Biol Chem1989;264:7576–83.

27.Oquendo P,Hundt E,Lawler J,Seed B.CD36directly mediates cytoadherence of plasmodium falciparum parasitized erythrocytes.Cell 1989;58:95–101.

28.Ge AZ,Butcher EC.Cloning and expression of a cDNA encoding mouse endoglin,an endothelial cell TGF-?ligand.Gene1994;138: 201–6.

29.Arthur HM,Ure J,Smith AJ,et al.Endoglin,an ancillary TGF?receptor,is required for extraembryonic angiogenesis and plays a key role in heart development.Dev Biol2000;217:42–53.

https://www.doczj.com/doc/0e7686393.html,ler DW,Graulich W,Karges B,et al.Elevated expression of endoglin,a component of TGF-?-receptor complex,correlates with proliferation of tumor endothelial cells.Int J Cancer1999;81:568–72.

31.Shetty SS,Okada T,Webb RL,DelGrande D,Lappe RW.Func-tionally distinct endothelin B receptors in vascular endothelium and smooth muscle.Biochem Biophys Res Comm1993;191:459–74. 32.Solovey AN,Gui L,Chang L,Enenstein J,Browne PV,Hebbel RP. Identification and functional assessment of endothelial P1H12.J Lab Clin Med2001;138:322–31.

33.Mutin M,Dignat-George F,Sampol J.Immunologic phenotype of cultured endothelial cells:quantitative analysis of cell surface mole-cules.Tissue Antigens1997;50:449–58.

34.Davis S,Aldrich TH,Jones PF,et al.Isolation of angiopoietin-1,a ligand for the TIE2receptor,by secretion-trap expression cloning.Cell 1996;87:1161–9.

35.Suri C,Jones PF,Patan S,et al.Requisite role of angiopoietin-1,a ligand for the TIE2receptor,during embryonic angiogenesis.Cell 1996;87:1171–80.

36.Maisonpierre PC,Suri C,Jones PF,et al.Angiopoietin-2,a natural antagonist for Tie-2that disrupts in vivio angiogenesis.Science(Lond) 1997;277:55–60.

37.Koblizek TI,Weiss C,Yancopolous GD,Deutsch U,Risau W. Angiopoietin-1induces sprouting angiogenesis in vitro.Curr Biol1998; 8:529–32.

38.Grooby WL,Krishnan R,Russ GR.Characterization of ovine umbilical vein endothelial cells and their expression of cell adhesion molecules:comparative study with human endothelial cells.Immunol Cell Biol1997;75:21–8.

39.Iiyama K,Hajra L,Iiyama M,et al.Patterns of vascular cell adhesion molecule-1and intercellular adhesion molecule-1expression in rabbit and mouse atherosclerotic lesions and at sites predisposed to lesion formation.Circ Res1999;86:199–207.

40.Charpin C,Garcia S,Andrac L,Horschowski N,Choux R,Lavaut MN.VCAM(IGSF)adhesion molecule expression in breast carcinomas detected by automated and quantitative immunocytochemical assays. Hum Pathol1998;29:896–903.

https://www.doczj.com/doc/0e7686393.html,lauer B,Wizigmann-Voos S,Schnurch H,et al.High affinity VEGF binding and developmental expression suggest FLK-1as a major regulator of vasculogenesis and angiogenesis.Cell1993;72:835–46.

42.Sawano A,Iwai S,Sakurai Y,et al.Flt-1,vascular endothelial growth factor receptor1,is a novel cell surface marker for the lineage of monocyte-macrophages in humans.Blood2001;97:785–91.

43.Jin K,Zhu Y,Sun Y,Mao XO,Xie L,Greenberg DA.Vascular endothelial growth factor(VEGF)stimulates neurogenesis in vitro and in vivo.Proc Natl Acad Sci USA2002;99:11946–50.

2188Mouse Model of In Vitro Angiogenesis

44.Fan L,Wakayama T,Yokoyama S,Amano O,Iseki S.Downregu-lation of vascular endothelial growth factor and its receptors in the kidney in rats with puromycin aminonucleoside nephrosis.Nephron 2002;90:95–102.

45.Bosma MJ,Carroll AM.The SCID mouse mutant:definition, characterization,and potential uses.Ann Rev Immunol1991;9:323–50.

46.Brooks PC,Montgomery AM,Rosenfeld M,et al.Integrin?v?3 antagonists promote tumor regression by inducing apoptosis of angio-genic blood vessels.Cell1994;79:1157–64.

47.Schechner JS,Nath AK,Zheng L,et al.In vivo formation of complex microvessels lined by human endothelial cells in an immuno-deficient mouse.Proc Natl Acad Sci USA2000;97:9191–6.48.Nor JE,Christensen J,Mooney DJ,Polverini PJ.Vascular endo-thelial growth factor(VEGF)-mediated angiogenesis is associated with enhanced endothelial cell survival and induction of bcl-e expression.

Am J Pathol1999;154:375–84.

49.Yang J,Nagavarapu U,Relloma K,et al.Telomerized human microvasculature is functional in vivo.Nat Biotechnol2001;19:219–24. 50.Greiner DL,Hesselton RA,Shultz LD.SCID mouse models of human stem cell engraftment.Stem Cells1998;16:166–77.

51.Raychaudhuri SP,Sanyal M,Raychaudhuri SK,Dutt S,Farber EM. Sever combined immunodeficiency mouse-human skin chimeras:a unique animal model for the study of psoriasis and cutaneous inflam-mation.Br J Dermatol2001;144:931–9.

2189

Clinical Cancer Research

2004;10:2179-2189.

Clin Cancer Res

Jennifer Walter-Yohrling, Sharon Morgenbesser, Cecile Rouleau, et al.

Endothelial Cells

Murine Endothelial Cell Lines as Models of Tumor

Updated version

https://www.doczj.com/doc/0e7686393.html,/content/10/6/2179Access the most recent version of this article at:

Cited articles

https://www.doczj.com/doc/0e7686393.html,/content/10/6/2179.full.html#ref-list-1This article cites 48 articles, 14 of which you can access for free at:

Citing articles

https://www.doczj.com/doc/0e7686393.html,/content/10/6/2179.full.html#related-urls This article has been cited by 11 HighWire-hosted articles. Access the articles at:

E-mail alerts